SubtiWiki SubtiWiki
ydeD

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ydeD
168

unknown

locus
BSU_05160
Molecular weight
35.16 kDa
pI
9.62
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ydeD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0697

This gene is a member of the following regulons

Gene
Coordinates
562,502  563,461
The protein
Protein family
[wiki|EamA transporter family] (according to UniProt)
[wiki|Domains]
2[wiki|EamA domain]s (aa 18-149, aa 171-296) (according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Biological materials
Mutant
MGNA-C080 (ydeD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2078 NBRP B. subtilis, Japan]
BKE05160 ([gene|3BD05DE3ED5B293980F47EB621C54C7339F78DC7|ydeD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05160 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACATGACTCCTCACTAA,  downstream forward: _UP4_TAGGGGCTTTTTTTGCTTAC
BKK05160 ([gene|3BD05DE3ED5B293980F47EB621C54C7339F78DC7|ydeD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05160 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACATGACTCCTCACTAA,  downstream forward: _UP4_TAGGGGCTTTTTTTGCTTAC

3BD05DE3ED5B293980F47EB621C54C7339F78DC7

Page visits: 869

Time of last update: 2022-01-15 03:11:56

Author of last update: Melvin.boenninger