yqfX

yqfX
168

unknown

locus
BSU_25080
Molecular weight
13.76 kDa
pI
4.53
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yqfX

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5921

This gene is a member of the following regulons

Gene
Coordinates
2,590,282  2,590,671
The protein
Structure
[AF|P54481]
Expression and Regulation
Operons
genes
[gene|3BFD8FAAC51E7B128A5C860D77C6D4E131E5D7ED|yqfX]
description
[pubmed|22383849]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|3BFD8FAAC51E7B128A5C860D77C6D4E131E5D7ED|yqfX]

2022-12-18 20:47:05

Bzhu

11

f88b68dced4c16e901475f507c455effb3155f54

30C35892F5FCB2249CB41E6F19C3B1325E4E7D28

additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
Mutant
BKE25080 ([gene|3BFD8FAAC51E7B128A5C860D77C6D4E131E5D7ED|yqfX]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE25080 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTCCCCCTTCTGTTTTA,  downstream forward: _UP4_TAACACAAAAAAGCTTGACG
BKK25080 ([gene|3BFD8FAAC51E7B128A5C860D77C6D4E131E5D7ED|yqfX]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK25080 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTCCCCCTTCTGTTTTA,  downstream forward: _UP4_TAACACAAAAAAGCTTGACG
References
Reviews
35638784
Original Publications
30782632

3BFD8FAAC51E7B128A5C860D77C6D4E131E5D7ED

Page visits: 882

Time of last update: 2023-02-04 15:33:17

Author of last update: Jstuelk