yhaJ

yhaJ
168

putative bacteriocin

locus
BSU_09965
Molecular weight
20.00 kDa
pI
9.44
Protein length
Gene length
function
unknown
product
putative bacteriocin
essential
no
ec
null
synonyms
yhaJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,072,042  1,072,560
The protein
Structure
[AF|O07518]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|3C7A7CA1EE4A785436FA49C90546E3F3B3ABF0A6|yhaJ]
description
[pubmed|22383849]
Open in new tab

[gene|3C7A7CA1EE4A785436FA49C90546E3F3B3ABF0A6|yhaJ]

2022-12-01 03:24:57

Jstuelk

14

561760e834495e13062d207064f1b7dbd00902a3

4800EDAEC67368EB2755385233B9C7D5F49ABCAF

Biological materials
Mutant
BKE09965 ([gene|3C7A7CA1EE4A785436FA49C90546E3F3B3ABF0A6|yhaJ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE09965 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCAAAGTCATCCTTCCAT,  downstream forward: _UP4_TAGTCAAACCCTGGTGCTGG
BKK09965 ([gene|3C7A7CA1EE4A785436FA49C90546E3F3B3ABF0A6|yhaJ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK09965 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCAAAGTCATCCTTCCAT,  downstream forward: _UP4_TAGTCAAACCCTGGTGCTGG
References
16845009

3C7A7CA1EE4A785436FA49C90546E3F3B3ABF0A6

Page visits: 918

Time of last update: 2022-11-30 17:58:10

Author of last update: Melvin.boenninger