yukD

yukD
168

Ubiquitin-like protein, part of the type VII protein secretion system [protein|3CC3E197848E9688413C15CEA7DDCF0A7120A920|yukD]-[protein|3FE4A91C7D0B43C8704391F2F9493852B3AED9B0|essB]-[protein|6007664F3D979B4D8D4662C7F6E5CF2F489268E3|yukB]-[protein|0A38B2E900532C9950DE6E629F5EB21D64E18B55|yueB]-[protein|DA52C4CD130F32734E01A52F2F395127D2260F61|yueC], putative bacteriocin

locus
BSU_31900
Molecular weight
8.94 kDa
pI
6.31
Protein length
Gene length
function
export of [protein|50D2A03E2D7B5D461540FD157377E0D37F771888|yukE]
product
ubiquitin-like protein, part of the type VII protein secretion system, putative bacteriocin
essential
no
synonyms
yukD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5417

This gene is a member of the following regulons

Gene
Coordinates
3,275,832  3,276,071
Phenotypes of a mutant
loss of secretion of [protein|50D2A03E2D7B5D461540FD157377E0D37F771888|yukE] [Pubmed|24798022]
The protein
Catalyzed reaction/ biological activity
export of [protein|50D2A03E2D7B5D461540FD157377E0D37F771888|yukE] [Pubmed|24828531,23861817]
secretion and delivery of [wiki|LXG domain] toxins [pubmed|34280190]
Protein family
EsaB family (single member, according to UniProt)
Structure
[PDB|2BPS]
[AF|P71071]
Expression and Regulation
Operons
genes
[gene|50D2A03E2D7B5D461540FD157377E0D37F771888|yukE]-[gene|3CC3E197848E9688413C15CEA7DDCF0A7120A920|yukD]-[gene|3FE4A91C7D0B43C8704391F2F9493852B3AED9B0|essB]-[gene|6007664F3D979B4D8D4662C7F6E5CF2F489268E3|yukB]-[gene|0A38B2E900532C9950DE6E629F5EB21D64E18B55|yueB]-[gene|DA52C4CD130F32734E01A52F2F395127D2260F61|yueC]-[gene|B258CA26B0EC2310475FCCD67F1F196857FC0004|yueD]
description
[Pubmed|22383849]
regulation
expressed in the stationary phase [Pubmed|23861817]
expression is reduced in motile cells as compared to non-motile cells [pubmed|33782055]
regulatory mechanism
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P, [Pubmed|23861817], in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|22383849], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|50D2A03E2D7B5D461540FD157377E0D37F771888|yukE]→[gene|B258CA26B0EC2310475FCCD67F1F196857FC0004|yueD]

2022-11-26 17:39:22

Jstuelk

60

BB0E1B9684F16E121BAA022EF986B0285FB41FA7

CDC40F8A7006CF56CF9A6155897E8BD27FFEC7AA

Biological materials
Mutant
MGNA-A627 (yukD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/627 NBRP B. subtilis, Japan]
BKE31900 ([gene|3CC3E197848E9688413C15CEA7DDCF0A7120A920|yukD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE31900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTAGGATCACCCTTACA,  downstream forward: _UP4_ATATTATGAAAGGATCTGGT
BKK31900 ([gene|3CC3E197848E9688413C15CEA7DDCF0A7120A920|yukD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK31900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTAGGATCACCCTTACA,  downstream forward: _UP4_ATATTATGAAAGGATCTGGT
References
Reviews
19155186,11973144
Original Publications
15576783,16845009,22383849,23861817,15978580,24798022,34280190,36154281

3CC3E197848E9688413C15CEA7DDCF0A7120A920

Page visits: 1710

Time of last update: 2022-11-28 19:50:43

Author of last update: Jstuelk