ribR

ribR
168

riboflavin kinase with preference for dihydroriboflavin, binds FMN riboswitches of the rib operon and of ribU to allow expression even in the presence of FMN, required for the conversion of S-methyl-cysteine to cysteine

locus
BSU_29300
Molecular weight
26.08 kDa
pI
9.28
Protein length
Gene length
function
utilization of S-methyl-cysteine, regulation of rib operon expression
product
riboflavin kinase with preference for dihydroriboflavin
essential
no
synonyms
ribR, ytnK, rbfK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0196

This gene is a member of the following regulons

Gene
Coordinates
3,000,985  3,001,677
Phenotypes of a mutant
no growth with S-methyl cysteine [Pubmed|23944997]
The protein
Catalyzed reaction/ biological activity
synthesis of FMNH2 [Pubmed|26494285]
binds the [wiki|FMN riboswitch] [Pubmed|26494285]
prevents transcription termination of the ''[gene|3DFCF7C5FE15C9A3E9E7E4B0DA8E926B85DBD180|ribD]-[gene|4E18BD4B084094EE4FBC8FE2AC95B14581D20C0F|ribE]-[gene|F07B7062C850106A95C15978E36DA500F8B089D6|ribA]-[gene|2A5DCBFAB51996F0DDEC964D5D178274AF86CE69|ribH]-[gene|8146A052E4E7844F781E7169C264EC927DEB7387|ribT]'' operon even in the presence of FMN or FMNH2 [Pubmed|26494285]
prevents sequestration of the ribosome binding site of the ''[gene|651C370386E9FB45E3B98001800D342FEDB43E9A|ribU]'' mRNA even in the presence of FMN or FMNH2 [Pubmed|26494285]
ATP + riboflavin --> ADP + FMN + H+ (according to UniProt)
Protein family
RibR family (single member, according to UniProt)
Structure
[AF|P94465]
Paralogous protein(s)
[protein|85E732993186528CF58FECFFE89C8F39D278F28D|ribC], (42%)
Expression and Regulation
Operons
genes
[gene|E3F1B3A4086DBC40FD9AE9CD6981270FBDFA6CAF|snaA]-[gene|A6A13C54177381CE78ABA2CFC2A3F2CE12099F15|tcyJ]-[gene|A8FA40EACDB15CF53DDDA725A3AA5A6EB654FA8B|tcyK]-[gene|350C97E4A4C60A6E2FF9610D50B4A49FB9F9B42D|tcyL]-[gene|B1DD32A3B3D1C0C5391A40834940257357A2F30F|tcyM]-[gene|B24763A732111026D21C828FF9BE73FB22A123CF|tcyN]-[gene|EDC3565D90D7059A4A4C66A13EB568420F6CECD4|cmoO]-[gene|FCD25CA4414D689B217F54B0C44EB805F9590454|cmoI]-[gene|8145952307BC47805A7A9BD39418474358043BFE|cmoJ]-[gene|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR]-[gene|0DE66A10D9475DC57A140561E8532D3EC038FD6F|sndA]-[gene|910EAAF48C85D0364751EC9585121246AF677431|ytnM]
description
[Pubmed|15668000]
regulation
induced in the presence of methionine and taurine [Pubmed|11390694]
regulatory mechanism
[protein|50930C56C27D22715620A350220E3C56ADB41020|cymR]: repression, [Pubmed|16109943], in [regulon|protein:50930C56C27D22715620A350220E3C56ADB41020|cymR regulon]
[protein|741156D495BE3857683C8A0390764EAD83845ABC|ascR]: activation, [Pubmed|16109943], in [regulon|protein:741156D495BE3857683C8A0390764EAD83845ABC|ascR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15272571], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|E3F1B3A4086DBC40FD9AE9CD6981270FBDFA6CAF|snaA]→[gene|910EAAF48C85D0364751EC9585121246AF677431|ytnM]

2022-11-29 22:26:45

Jstuelk

38

8a3868e633778d2f68bf47d615f22f716e843294

4D6CA410A1DC104A491D3C18248CCD50CC0E983A

Biological materials
Mutant
MGNA-A154 (ribR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/154 NBRP B. subtilis, Japan]
BKE29300 ([gene|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE29300 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAAAAGTCAGCCTCCTCT,  downstream forward: _UP4_GGATAGGGAAAGGAGCGGAA
BKK29300 ([gene|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK29300 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAAAAGTCAGCCTCCTCT,  downstream forward: _UP4_GGATAGGGAAAGGAGCGGAA
References
17590224,15668000,16109943,15272571,23944997,11390694,26494285

3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6

Page visits: 3856

Time of last update: 2022-12-03 11:17:38

Author of last update: Melvin.boenninger