SubtiWiki SubtiWiki
sigW

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

sigW
168

[wiki|RNA polymerase] ECF-type [wiki|sigma factor] SigW, required for the adaptation to membrane active agents, activated by alkaline shock and by polymyxin B, vancomycin, cephalosporin C, D-cycloserine, and triton X-100

locus
BSU_01730
Molecular weight
21.57 kDa
pI
8.61
Protein length
Gene length
function
adaptation to membrane-active compounds
product
[wiki|RNA polymerase] ECF-type [wiki|sigma factor] SigW
essential
no
synonyms
sigW, ybbL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1595

This gene is a member of the following regulons

Gene
Coordinates
194,849  195,412
Phenotypes of a mutant
sensitive to -lactam antibiotics such as cefuroxime and to fosfomycin [Pubmed|22178969]
Inactivation of ''[gene|8BA7714236EBFDBB9987F1DACC9775AD974C743E|alsR]'', ''[gene|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]'' and ''[gene|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]'' increases competitive fitness of ''Bacillus subtilis'' under non-sporulating conditions [Pubmed|22344650]
The protein
Protein family
[wiki|Sigma-70 factor family] (according to UniProt)
[wiki|ECF subfamily] (according to UniProt)
Structure
[PDB|5WUQ] (complex with the cytoplasmic domain of [protein|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|rsiW]) [pubmed|28319136]
Effectors of protein activity
[protein|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|rsiW] acts as antagonist of SigW (anti-SigW)
Expression and Regulation
Operons
genes
[gene|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]-[gene|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|rsiW]
description
[Pubmed|12207695]
regulation
induced under conditions of alkali shock or in the presence of the toxin [protein|search|SdpC] ([protein|search|SigW]) [Pubmed|12207695]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|12076816], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|12207695], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
additional information
the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
Open in new tab

[gene|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]→[gene|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|rsiW]

2022-01-20 15:40:08

ghost

14

f173494f184da3acb9643a06d22253706f42bb28

A73BFA90A2F503CCE374A383B36C83668CF7F3DD

Biological materials
Mutant
1A905 ( ''sigW''::''erm''), [Pubmed|11244082], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A905&Search=1A905 BGSC]
BKE01730 ([gene|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01730 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTTATCTAACCTCTGC,  downstream forward: _UP4_AGGGATCTTTAAGTGGGGTG
BKK01730 ([gene|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01730 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTTATCTAACCTCTGC,  downstream forward: _UP4_AGGGATCTTTAAGTGGGGTG
labs
[wiki|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
[wiki|Thomas Wiegert], University of Bayreuth, Germany [http://www.genetik.uni-bayreuth.de/LSGenetik1/Thomas Wiegert-Dateien/Thomas Wiegert.html Homepage]
References
Reviews
22381678,24921931,26901131,27344142,29343670
Other original publications
11222589,14993308,16816000,17338440,12207695,11454200,14563871,12076816,19820159,21821766,22344650,14993308,23185515,20817771,21542858,22178969,27137497,27977677,28319136,29454936,31461489
The [wiki|SigW regulon]
9683469,16629676,17675383,11866510,9987136,10960106,23934352,23155385

3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D

Page visits: 4933

Time of last update: 2022-01-21 05:05:22

Author of last update: Jstuelk