
At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!


transcriptional repressor of the [gene|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]-[gene|4BA5214C441C6671CB7DAA3CACBCA5FC025BE0E6|yrhJ] operon

Molecular weight
22.07 kDa
Protein length
Gene length
transcriptional repressor of the [gene|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]-[gene|4BA5214C441C6671CB7DAA3CACBCA5FC025BE0E6|yrhJ] operon ([wiki|TetR family])
fatR, yrhI, bscR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1309

This gene is a member of the following regulons

2,777,070  2,777,654
The protein
Protein family
[wiki|TetR family]
[wiki|HTH tetR-type domain] (aa 6-66) (according to UniProt)
[PDB|4ME9] (from B. cereus, 38% identity)
phosphorylated by [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA] on Tyr-45, this results in displacement of FatR from the DNA [Pubmed|23939619]
Expression and Regulation
expression is reduced in a [protein|search|SigV] mutant [Pubmed|21926231]
regulatory mechanism
[protein|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]: repression, [Pubmed|11734890], in [regulon|protein:3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR regulon]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421,12775685], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|12207695], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [Pubmed|9636707], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
additional information
A [protein|search|ncRNA] ([wiki|RnaC]) is encoded between '[protein|search|yrhK]' and '[protein|search|yrhJ]' [PubMed|25790031]
Open in new tab


2022-05-19 15:42:45





Expressed under stress conditions ([protein|search|SigW], [protein|search|SigX]) [Pubmed|9683469]
additional information
A [protein|search|ncRNA] ([wiki|RnaC]) is encoded between '[protein|search|yrhK]' and '[protein|search|yrhJ]' [PubMed|25790031]
Open in new tab


2022-05-16 05:38:21





Biological materials
MGNA-A177 (yrhI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/177 NBRP B. subtilis, Japan]
BKE27170 ([gene|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAATCTGACAACCTCC,  downstream forward: _UP4_CAAAAATAGGAAAGGGAGAT
BKK27170 ([gene|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAATCTGACAACCTCC,  downstream forward: _UP4_CAAAAATAGGAAAGGGAGAT


Page visits: 2666

Time of last update: 2022-05-20 20:45:44

Author of last update: Melvin.boenninger