fatR

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

fatR
168

transcriptional repressor of the [gene|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]-[gene|4BA5214C441C6671CB7DAA3CACBCA5FC025BE0E6|yrhJ] operon

locus
BSU_27170
Molecular weight
22.07 kDa
pI
5.62
Protein length
Gene length
function
unknown
product
transcriptional repressor of the [gene|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]-[gene|4BA5214C441C6671CB7DAA3CACBCA5FC025BE0E6|yrhJ] operon ([wiki|TetR family])
essential
no
synonyms
fatR, yrhI, bscR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1309

This gene is a member of the following regulons

Gene
Coordinates
2,777,070  2,777,654
The protein
Protein family
[wiki|TetR family]
[wiki|Domains]
[wiki|HTH tetR-type domain] (aa 6-66) (according to UniProt)
Structure
[PDB|4ME9] (from B. cereus, 38% identity)
[AF|O08335]
Modification
phosphorylated by [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA] on Tyr-45, this results in displacement of FatR from the DNA [Pubmed|23939619]
Expression and Regulation
Operons
genes
[gene|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]-[gene|4BA5214C441C6671CB7DAA3CACBCA5FC025BE0E6|yrhJ]
description
[Pubmed|10917605]
regulation
expression is reduced in a [protein|search|SigV] mutant [Pubmed|21926231]
regulatory mechanism
[protein|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]: repression, [Pubmed|11734890], in [regulon|protein:3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR regulon]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421,12775685], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|12207695], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [Pubmed|9636707], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
additional information
A [protein|search|ncRNA] ([wiki|RnaC]) is encoded between '[protein|search|yrhK]' and '[protein|search|yrhJ]' [PubMed|25790031]
Open in new tab

[gene|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]→[gene|4BA5214C441C6671CB7DAA3CACBCA5FC025BE0E6|yrhJ]

2022-05-19 15:42:45

ghost

9

66cb5559018da57885af62dd768f226a6671d3f3

217BE52444D2B4A4024C5CD0426AE4112885843E

genes
[gene|6D5089931FBDB398A7FAF3C8DDF341EB4949AEFE|yrhH]-[gene|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]-[gene|4BA5214C441C6671CB7DAA3CACBCA5FC025BE0E6|yrhJ]
description
[Pubmed|18179421]
regulation
Expressed under stress conditions ([protein|search|SigW], [protein|search|SigX]) [Pubmed|9683469]
additional information
A [protein|search|ncRNA] ([wiki|RnaC]) is encoded between '[protein|search|yrhK]' and '[protein|search|yrhJ]' [PubMed|25790031]
Open in new tab

[gene|6D5089931FBDB398A7FAF3C8DDF341EB4949AEFE|yrhH]→[gene|4BA5214C441C6671CB7DAA3CACBCA5FC025BE0E6|yrhJ]

2022-05-16 05:38:21

ghost

11

6a319165d87b6e310ceee6802fc5be1260c7635a

96207AF27502FF7704502BDB88571F1FEBAA2D56

Biological materials
Mutant
MGNA-A177 (yrhI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/177 NBRP B. subtilis, Japan]
BKE27170 ([gene|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAATCTGACAACCTCC,  downstream forward: _UP4_CAAAAATAGGAAAGGGAGAT
BKK27170 ([gene|3DA3FFB295F5513A220CB163994EE0F356C810E6|fatR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAATCTGACAACCTCC,  downstream forward: _UP4_CAAAAATAGGAAAGGGAGAT
References
11734890,11574077,11377867,10917605,12207695,9636707,23939619,21926231

3DA3FFB295F5513A220CB163994EE0F356C810E6

Page visits: 2671

Time of last update: 2022-05-24 20:06:19

Author of last update: Melvin.boenninger