ybfE

ybfE
168

unknown

locus
BSU_02180
Molecular weight
10.90 kDa
pI
9.13
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ybfE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
238,164  238,448
The protein
Structure
[AF|O31445]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|5D159F09BFD98B58A7EDAD37A4DB6468A702D09A|ybfG]-[gene|CEA0A2CE520B8A6E8E9D7C079B954B24137DF686|ybfF]-[gene|3E2A864B904DE4D9F72D2B19257AE81CCED3BE12|ybfE]
description
[Pubmed|22383849]
regulation
the mRNA is processed between [gene|5D159F09BFD98B58A7EDAD37A4DB6468A702D09A|ybfG] and [gene|CEA0A2CE520B8A6E8E9D7C079B954B24137DF686|ybfF] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|ymcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|ylbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT] complex [Pubmed|29794222]
Open in new tab

[gene|5D159F09BFD98B58A7EDAD37A4DB6468A702D09A|ybfG]→[gene|3E2A864B904DE4D9F72D2B19257AE81CCED3BE12|ybfE]

2022-11-28 11:01:05

Jstuelk

19

a49dee176b04a3a768734405a486d711023e5222

5ACCA6A4CEE5C3AA9502B1405FF352BEFA5B2B53

Biological materials
Mutant
MGNA-B966 (ybfE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1965 NBRP B. subtilis, Japan]
BKE02180 ([gene|3E2A864B904DE4D9F72D2B19257AE81CCED3BE12|ybfE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02180 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTAAAGAATACCTTTAAT,  downstream forward: _UP4_TAATCTCGAAATCAGAGATG
BKK02180 ([gene|3E2A864B904DE4D9F72D2B19257AE81CCED3BE12|ybfE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02180 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTAAAGAATACCTTTAAT,  downstream forward: _UP4_TAATCTCGAAATCAGAGATG

3E2A864B904DE4D9F72D2B19257AE81CCED3BE12

Page visits: 760

Time of last update: 2022-12-06 02:07:54

Author of last update: Melvin.boenninger