gerD

gerD
168

scaffold of the germinosome, required for clustering of germinant receptors in the spore inner membrane

locus
BSU_01550
Molecular weight
20.97 kDa
pI
4.86
Protein length
Gene length
function
germination
product
lipoprotein
essential
no
synonyms
gerD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5904

This gene is a member of the following regulons

Gene
Coordinates
158,515  159,072
Phenotypes of a mutant
defective in [wiki|germination] in response to nutrients [Pubmed|24530795]
The protein
Catalyzed reaction/ biological activity
required for clustering of germinant receptors in the spore inner membrane [Pubmed|21696470]
[wiki|Domains]
has an N-terminal signal sequence and a signal for fixation to lipid [Pubmed|23335419]
Structure
[PDB|4O8W] [Pubmed|24530795]
[AF|P16450]
[wiki|Localization]
outer surface of the inner spore membrane [Pubmed|23335419,21696470]
inner spore membrane, spore coat, cortex, germ cell wall, some GerD is also present in the soluble fraction [Pubmed|19332816]
Additional information
3,500 molecules are present per spore [Pubmed|23749970]
Expression and Regulation
Operons
genes
[gene|3E5B9AC0C6F974800DE1ABF25769D24947772DCB|gerD]
description
[Pubmed|2517635]
regulation
expression level depends on sporulation conditions (medim composition, temperature) [Pubmed|22327596]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|15699190], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|1906867,15699190], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
additional information
3,500 molecules are present per spore [PubMed|23749970]
Open in new tab

[gene|3E5B9AC0C6F974800DE1ABF25769D24947772DCB|gerD]

2022-11-14 21:58:38

ghost

26

4d937204f4c653e258eb65412311ee6bda2e3adc

F4E5BFF9FE2738D9DBEF91F942900C20586B0554

Biological materials
Mutant
1A677 ( ''gerD''::''erm''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A677&Search=1A677 BGSC]
1G17 ( ''gerD''::''spec''), [Pubmed|15126458], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1G17&Search=1G17 BGSC]
BKE01550 ([gene|3E5B9AC0C6F974800DE1ABF25769D24947772DCB|gerD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTTAAGCTCCTTTCAC,  downstream forward: _UP4_TAAAGGGAAAGCCGGGATCT
BKK01550 ([gene|3E5B9AC0C6F974800DE1ABF25769D24947772DCB|gerD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTTAAGCTCCTTTCAC,  downstream forward: _UP4_TAAAGGGAAAGCCGGGATCT
Antibody
available in [wiki|Anne Moir] lab
labs
[wiki|Anne Moir], University of Sheffield, UK
References
1906867,19332816,17122337,21725007,18556788,19332816,2517635,21696470,22327596,22493018,23335419,23749970,21398556,24530795,24752279,26731423,35638784

3E5B9AC0C6F974800DE1ABF25769D24947772DCB

Page visits: 2870

Time of last update: 2022-11-27 04:07:52

Author of last update: Jstuelk