ykuS

ykuS
168

unknown

locus
BSU_14200
Molecular weight
8.36 kDa
pI
4.01
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ykuS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,490,939  1,491,184
The protein
Protein family
UPF0180 family (single member, according to UniProt)
Structure
[AF|O34783]
Expression and Regulation
Operons
genes
[gene|716FE06124544C05CC34BA2E643B4DBD27F04998|ykuQ]-[gene|D6F1906CE8386F78F451D6B794F74DE4AD25AC9C|ykuR]-[gene|3E7E0342AA86AFCC95F5CD5BEA5B10166DCE2721|ykuS]
description
[Pubmed|22383849]
Open in new tab

[gene|716FE06124544C05CC34BA2E643B4DBD27F04998|ykuQ]→[gene|3E7E0342AA86AFCC95F5CD5BEA5B10166DCE2721|ykuS]

2022-06-12 08:37:07

Jstuelk

23

cd9e2fdc932f01581710e276a91df586a6d39c25

30EDD1FD8E81987B92126BC0CB4F32A7343A78F7

genes
[gene|3E7E0342AA86AFCC95F5CD5BEA5B10166DCE2721|ykuS]
description
[Pubmed|22383849]
Open in new tab

[gene|3E7E0342AA86AFCC95F5CD5BEA5B10166DCE2721|ykuS]

2022-06-20 06:51:42

Jstuelk

11

a3988547d15854d475af0480a30341913a4b41aa

653DB509532D4E798EA73C9CC8F59444F2D08CD6

Biological materials
Mutant
BKE14200 ([gene|3E7E0342AA86AFCC95F5CD5BEA5B10166DCE2721|ykuS]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14200 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTTGAACACCTCCGTT,  downstream forward: _UP4_TAATAAAAAAACCGAAGCAA
BKK14200 ([gene|3E7E0342AA86AFCC95F5CD5BEA5B10166DCE2721|ykuS]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14200 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTTGAACACCTCCGTT,  downstream forward: _UP4_TAATAAAAAAACCGAAGCAA

3E7E0342AA86AFCC95F5CD5BEA5B10166DCE2721

Page visits: 965

Time of last update: 2022-06-25 14:34:29

Author of last update: Melvin.boenninger