bacA

bacA
168

bacilysin biosynthesis protein, prephenate decarboxylase

locus
BSU_37740
Molecular weight
23.18 kDa
pI
7.9
Protein length
Gene length
function
biosynthesis of the antibiotic bacilysin
product
anticapsin biosynthesis protein, prephenate decarboxylase
essential
no
ec
null
synonyms
bacA, ywfB, ipa-80d

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0077

This gene is a member of the following regulons

Gene
Coordinates
3,873,566  3,874,180
Phenotypes of a mutant
defective in sporulation timing [pubmed|34460312]
The protein
Catalyzed reaction/ biological activity
decarboxylation of prephenate [Pubmed|19776011]
H+ + prephenate --> 3-[(4R)-4-hydroxycyclohexa-1,5-dien-1-yl]-2-oxopropanoate + CO2 (according to UniProt)
Protein family
prephenate decarboxylase family (single member, according to UniProt)
Structure
[AF|P39638]
Expression and Regulation
Operons
genes
[gene|3F49F4AEFC49C2883EFA60FEB3E77591F184195B|bacA]-[gene|0EEE23875DB720D256D53F00D1AD5EF24B538B27|bacB]-[gene|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|bacC]-[gene|2CE0C0484A70EEE40277996CD3D564A84FEAF5B3|bacD]-[gene|4D2AD84E74888EC61E44DE5B8E31812F43250B05|bacE]-[gene|99434727013FCCD6E570AE550560A8546F7F2A41|bacF]
description
[Pubmed|12372825]
regulation
heterogeneous expression, percentage of expressing cells increases during colonization of plant roots [pubmed|34557426]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|12372825,21709425], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|12697329,21709425], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]: repression, [Pubmed|19801406], in [regulon|protein:F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|19801406], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|3F49F4AEFC49C2883EFA60FEB3E77591F184195B|bacA]→[gene|99434727013FCCD6E570AE550560A8546F7F2A41|bacF]

2023-02-05 16:33:40

Jstuelk

54

7D644717829C1A41F65E52A4312081846FB55951

33F4BF1A14F6AC22A6ACC7091140A7F012E3837C

Biological materials
Mutant
MGNA-B239 (ywfB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1238 NBRP B. subtilis, Japan]
BKE37740 ([gene|3F49F4AEFC49C2883EFA60FEB3E77591F184195B|bacA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE37740 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAGCACCAACCAATCTT,  downstream forward: _UP4_TTATTTGGAAAAGGAGACGT
BKK37740 ([gene|3F49F4AEFC49C2883EFA60FEB3E77591F184195B|bacA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK37740 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAGCACCAACCAATCTT,  downstream forward: _UP4_TTATTTGGAAAAGGAGACGT
References
15609023,12399481,12372825,21948839,19776011,19801406,20052993,12697329,21709425,31113899,34460312,34557426,31989543

3F49F4AEFC49C2883EFA60FEB3E77591F184195B

Page visits: 4043

Time of last update: 2023-02-07 14:56:01

Author of last update: Jstuelk