yxcE

yxcE
168

unknown

locus
BSU_39790
Molecular weight
22.93 kDa
pI
10.52
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yxcE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
4,086,802  4,087,452
The protein
Structure
[AF|P46335]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|3F86D8ADA92D091F40B2A33F9613630F3D84C212|yxcE]-[gene|C3183F5ADCA6C85B9564E69761CD37ECBE636AD1|yxcD]
description
[Pubmed|10746760]
Open in new tab

[gene|3F86D8ADA92D091F40B2A33F9613630F3D84C212|yxcE]→[gene|C3183F5ADCA6C85B9564E69761CD37ECBE636AD1|yxcD]

2022-08-19 15:32:55

ghost

7

75d8bbdb7789f78e2e7a9cd2d5146f484b5e15cd

B189E07844D01C25B12AF48495D7F7B2277030E0

Biological materials
Mutant
MGNA-B696 (yxcE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1695 NBRP B. subtilis, Japan]
BKE39790 ([gene|3F86D8ADA92D091F40B2A33F9613630F3D84C212|yxcE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE39790 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTGTTTCCTCCATAGA,  downstream forward: _UP4_ACGTACAGAAGGAGATTTTA
BKK39790 ([gene|3F86D8ADA92D091F40B2A33F9613630F3D84C212|yxcE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK39790 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTGTTTCCTCCATAGA,  downstream forward: _UP4_ACGTACAGAAGGAGATTTTA
References
10746760

3F86D8ADA92D091F40B2A33F9613630F3D84C212

Page visits: 972

Time of last update: 2022-10-02 22:19:37

Author of last update: Melvin.boenninger