nasB

nasB
168

nitrate reductase (electron transfer subunit)

locus
BSU_03320
Molecular weight
84.57 kDa
pI
5.48
Protein length
Gene length
function
utilization of nitrate
product
nitrate reductase (electron transfer subunit)
essential
no
synonyms
nasB, nasBA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1251

This gene is a member of the following regulons

Gene
Coordinates
360,442  362,757
The protein
[wiki|Cofactors]
FAD  [Pubmed|11289299]
Structure
[PDB|3KLJ] (from Clostridium acetobutylicum, corresponds to aa 2 ... 371, 27% identity) [pubmed|20017214]
[AF|P42433]
Paralogous protein(s)
[protein|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|nasD]
Expression and Regulation
Operons
genes
[gene|3F87227DC3371746B3823730B6A7024D348C151E|nasB]-[gene|EC8BF9A3BA88FE2A78C6F78A888E0D1E25C47BC5|nasC]-[gene|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|nasD]-[gene|A8998F46F68155A5C8AE2A2FBB95CA5A1635BB2B|nasE]-[gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]
description
[Pubmed|7836289]
regulation
''[protein|search|nasD]'': expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
regulatory mechanism
[protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]: activation, [Pubmed|10972836], in [regulon|protein:1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD regulon]
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, [PubMed|8799114,9765565], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|EC6697D5D945B7E5083AFED9218748763C443278|nsrR]: repression, [Pubmed|16885456], in [regulon|protein:EC6697D5D945B7E5083AFED9218748763C443278|nsrR regulon]
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]: repression, [pubmed|12354229], in [regulon|protein:F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7836289], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|3F87227DC3371746B3823730B6A7024D348C151E|nasB]→[gene|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF]

2022-09-30 20:26:53

ghost

24

f7e39891ce616efe86a59a87e70448f347bb9239

B3FDABF6DE6A38B053CBE30BA36088850B35E312

Biological materials
Mutant
1A971 ( ''nasB''::''erm''), [Pubmed|7868621], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A971&Search=1A971 BGSC]
BKE03320 ([gene|3F87227DC3371746B3823730B6A7024D348C151E|nasB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTATCAGACCTCCTTTG,  downstream forward: _UP4_TGAGGCATTTTGACTGAACG
BKK03320 ([gene|3F87227DC3371746B3823730B6A7024D348C151E|nasB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTATCAGACCTCCTTTG,  downstream forward: _UP4_TGAGGCATTTTGACTGAACG
References
Reviews
22103536,11289299
Original Publications
7836289,12823818,7868621,25755103,8799114,16885456,20017214

3F87227DC3371746B3823730B6A7024D348C151E

Page visits: 1104

Time of last update: 2022-09-30 18:05:19

Author of last update: Jstuelk