

immunity protein, protection against SdpC

Molecular weight
23.15 kDa
Protein length
Gene length
protection against SdpC
immunity protein
sdpI, yvaZ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5658

This gene is a member of the following regulons

3,466,434  3,467,057
The protein
Effectors of protein activity
in the presence of extracellular [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC], [protein|3FB5839A7A80CF52E627FF1744E50490F5CC390F|sdpI] binds and sequesters [protein|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR] , this results in induction of the ''[gene|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR]-[gene|3FB5839A7A80CF52E627FF1744E50490F5CC390F|sdpI]'' operon [Pubmed|16469701]
Paralogous protein(s)
[protein|2B7F65B145005A8ADD2A278E3EA5A52DF162C837|yfhL], [protein|2E0FBCA66FB88EDFD345FA289F776C7CA23976F5|ybgB]
membrane (according to UniProt)
Expression and Regulation
induced by extracellular [protein|search|SdpC] ([protein|search|SdpR]) [Pubmed|16469701]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|16469701], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR]: repression, [Pubmed|16469701], in [regulon|protein:29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|16469701], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2022-11-17 07:03:38





Biological materials
MGNA-A454 (yvaZ::erm), available at the [ NBRP B. subtilis, Japan]
BKE33780 ([gene|3FB5839A7A80CF52E627FF1744E50490F5CC390F|sdpI]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATTATGGAAATTATATTTT,  downstream forward: _UP4_TGAAAAAGTGTCTTGCGGAG
BKK33780 ([gene|3FB5839A7A80CF52E627FF1744E50490F5CC390F|sdpI]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATTATGGAAATTATATTTT,  downstream forward: _UP4_TGAAAAAGTGTCTTGCGGAG
Original Publications


Page visits: 1609

Time of last update: 2022-11-30 18:05:58

Author of last update: Melvin.boenninger