ctc

ctc
168

general stress protein, non-essential ribosomal protein BL25

locus
BSU_00520
Molecular weight
21.91 kDa
pI
4.22
Protein length
Gene length
function
[wiki|translation] (under stress conditions)
product
ribosomal protein BL25
essential
no
synonyms
ctc, rplY

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1825

This gene is a member of the following regulons

Gene
Coordinates
58,783  59,397
The protein
Protein family
Bacterial ribosomal protein bL25 family (single member, according to UniProt)
Structure
[PDB|1FEU] (from ''Thermus thermophilus'', 32% identity, 53% similarity) [Pubmed|11418764]
[AF|P14194]
[wiki|Localization]
in the ribosome (large subunit) [Pubmed|12432960]
Additional information
subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
Expression and Regulation
Operons
genes
[gene|23540C0D84F55135E39A09F48E48AB6F7C270B2E|gcaD]-[gene|37664AAEBFFDE1F7D17EA7C032805EA051FBE6AF|prs]-[gene|40624E9FC30D75D172EF098C7FAC77B2573CC129|ctc]
description
[Pubmed|22383849]
regulatory mechanism
stringent response: negative regulation, [pubmed|11948165], in [regulon|other_regulator:stringent response|stringent response]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [pubmed|8522540], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|23540C0D84F55135E39A09F48E48AB6F7C270B2E|gcaD]→[gene|40624E9FC30D75D172EF098C7FAC77B2573CC129|ctc]

2022-12-04 16:04:11

Jstuelk

52

8a2ec596272c7cfb42cb975d3b44431fc04457cf

58FF1AAE3D8324581B04A0D2CE6BF74D3CC7B05C

genes
[gene|40624E9FC30D75D172EF098C7FAC77B2573CC129|ctc]-[gene|FE7859E98F26E532AE02CD71B42B845BADBCF06E|spoVC]-[gene|C595D32D98723E93AF26B5C864FD61AF4739E069|fin]
description
[pubmed|22383849]
regulation
induced under stress conditions ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|40624E9FC30D75D172EF098C7FAC77B2573CC129|ctc]→[gene|C595D32D98723E93AF26B5C864FD61AF4739E069|fin]

2022-12-05 13:51:54

Jstuelk

54

042d8e5a6f42561738123d446c8cdfdcb7b024b0

AF90CE02D929F6F737FC233892E7E08A4B249DEC

genes
[gene|40624E9FC30D75D172EF098C7FAC77B2573CC129|ctc]
description
[Pubmed|22383849]
regulation
induced under stress conditions ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|40624E9FC30D75D172EF098C7FAC77B2573CC129|ctc]

2022-11-28 07:34:57

Jstuelk

48

067ea8dfffb79d5f3ee14c0843fef16f773eb92e

BF3CD41D8DA6BC51BB17AD7D22BDBE04FC5751E7

additional information
translation is substantially enhanced when the gene is transcribed by [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]-[wiki|RNA polymerase] [pubmed|33927010]
Biological materials
Mutant
MGNA-B912 (ctc::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1911 NBRP B. subtilis, Japan]
GP500(spc), available in [wiki|Jörg Stülke]'s lab [Pubmed|12432960]
CS206 (''[gene|40624E9FC30D75D172EF098C7FAC77B2573CC129|ctc]''::''aphA3'', available in [wiki|Colin Harwood]'s and [wiki|Jörg Stülke]'s labs) [Pubmed|27197833]
BKE00520 ([gene|40624E9FC30D75D172EF098C7FAC77B2573CC129|ctc]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTCAGCACCATCCTCT,  downstream forward: _UP4_TAATAGCTTAAGGCGTAACC
BKK00520 ([gene|40624E9FC30D75D172EF098C7FAC77B2573CC129|ctc]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTCAGCACCATCCTCT,  downstream forward: _UP4_TAATAGCTTAAGGCGTAACC
Expression vectors
expression/ purification with N-terminal His-tag in ''E. coli'': pGP804 (in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab [Pubmed|12432960]
Antibody
available in [wiki|Jörg Stülke]'s lab [Pubmed|12432960]
References
Reviews
19216708
Original Publications
2836704,3123466,3100810,8522540,15805528,12432960,6790515,2836704,116131,11418764,23002217,27197833,33753464,33927010

40624E9FC30D75D172EF098C7FAC77B2573CC129

Page visits: 3986

Time of last update: 2022-12-06 01:47:49

Author of last update: Jstuelk