

polyketide synthase

Molecular weight
475.31 kDa
Protein length
Gene length
polyketide synthesis
polyketide synthase

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3321

This gene is a member of the following regulons

1,821,553  1,834,341
The protein
4 [wiki|Carrier domain]s (aa 293-367, aa 2188-2261, aa 3409-3486, aa 4135-4212) (according to UniProt)
[PDB|6MHK] (from B. amyloliquefacies, corresponds to aa 395 ... 994, 2321 ... 2902, 3532 ... 4110, 73% identity)
Expression and Regulation
expressed during the transition from growth to stationary phase ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB], [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]) [Pubmed|24187085]
heterogeneous expression, percentage of expressing cells increases during colonization of plant roots [pubmed|34557426]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|24187085], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: activation, [Pubmed|24187085], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
additional information
this is a very large operon comprising about 75 kb
Open in new tab


2022-06-21 04:56:49





Open in new tab


2022-06-23 22:52:41





Biological materials
BKE17200 ([gene|40779D3A6E4F72EEFD702BF9FA15B57951783D12|pksM]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AGTTATCATTTTCCCACTCC,  downstream forward: _UP4_TAAAGAAATTCTCGATGCCT
BKK17200 ([gene|40779D3A6E4F72EEFD702BF9FA15B57951783D12|pksM]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AGTTATCATTTTCCCACTCC,  downstream forward: _UP4_TAAAGAAATTCTCGATGCCT


Page visits: 1759

Time of last update: 2022-06-17 18:14:31

Author of last update: Jstuelk