degQ
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

degQ
168

stimulates production of degradative enzymes and of extracellular poly-gamma-glutamate, stimulates phosphorylation of DegU by DegS, gene is not expressed in the lab strain 168 due to promoter down mutation in the -10 region (T - 10 ---> C)

locus
BSU_31720
Molecular weight
5.41 kDa
pI
6.54
Protein length
Gene length
function
regulation of exoenzyme synthesis
product
pleiotropic regulator
essential
no
synonyms
degQ, sacQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,257,092  3,257,232
Phenotypes of a mutant
loss of poly-gamma-glutamate production [Pubmed|16091050], no synthesis of nonribosomal peptides iturin A and plipastatin [http://www.ncbi.nlm.nih.gov/sites/entrez/16251307 PubMed1] [http://www.ncbi.nlm.nih.gov/sites/entrez/10471562 PubMed2], reduced synthesis of degradative enzymes [Pubmed|3098732], increased genetic competence [Pubmed|3098732]
The protein
Catalyzed reaction/ biological activity
stimulates autophosphorylation of [protein|047CE33C0CC127DAD15D68D63843DF89F93ED3BF|degS] [Pubmed|21965392]
Protein family
degQ family (single member, according to UniProt)
Structure
[AF|Q99039]
Expression and Regulation
Operons
genes
[gene|40C1E81BAB04BD1CC98FC57DF25D27DBDFEB5A59|degQ]
description
[Pubmed|3007431]
regulation
controlled by [protein|search|DegU] [Pubmed|1901055]
regulatory mechanism
[protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]: activation, [Pubmed|1901055], in [regulon|protein:7832489F11F606BCF637EC23BAAB41AD10237EBB|comA regulon]
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: activation, [Pubmed|1901055], in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|3007431], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
the gene is not expressed in the lab strain 168 due to promoter down mutation in the -10 region (T - 10 ---> C) [http://www.ncbi.nlm.nih.gov/sites/entrez/16091050 PubMed]
Open in new tab

[gene|40C1E81BAB04BD1CC98FC57DF25D27DBDFEB5A59|degQ]

2022-04-27 22:50:12

ghost

11

295bf9607a2c7fe56cbc482802ec9059c7e79c09

FB5DBB850B570B548EC4A9708026B89C05AD807D

Biological materials
Mutant
QB4851 (cat), available in [wiki|Jörg Stülke]'s lab
BKE31720 ([gene|40C1E81BAB04BD1CC98FC57DF25D27DBDFEB5A59|degQ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31720 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGTTTCCACACTCCTTT,  downstream forward: _UP4_TGAAAAAGACTTGGAAACAA
BKK31720 ([gene|40C1E81BAB04BD1CC98FC57DF25D27DBDFEB5A59|degQ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31720 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGTTTCCACACTCCTTT,  downstream forward: _UP4_TGAAAAAGACTTGGAAACAA
References
17850253,2428811,19447339,3007431,1901055,16091050,21278284,21965392,26302846,27920766,31272833,34713601

40C1E81BAB04BD1CC98FC57DF25D27DBDFEB5A59

Page visits: 4926

Time of last update: 2022-08-09 07:57:40

Author of last update: Jstuelk