frlR

frlR
168

transcriptional regulator ([wiki|GntR family])

locus
BSU_32560
Molecular weight
27.36 kDa
pI
6.42
Protein length
Gene length
function
regulation of utilization of sugar amines
product
transcriptional regulator ([wiki|GntR family])
essential
no
synonyms
frlR, yurK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2188

This gene is a member of the following regulons

Gene
Coordinates
3,346,298  3,347,026
The protein
Protein family
[wiki|GntR family] of transcription factors
[wiki|Domains]
[wiki|HTH gntR-type domain] (aa 8-76) (according to UniProt)
Structure
[PDB|2IKK] (C-terminal domain)
[AF|O32152]
Biological materials
Mutant
MGNA-A557 (yurK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/557 NBRP B. subtilis, Japan]
BKE32560 ([gene|412A1DBBE7F87765DEBEEAAE02A047636A354D5E|frlR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE32560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAGGGTAGCCTCCTTTTA,  downstream forward: _UP4_TAACAGGCATAAAAAACGAG
BKK32560 ([gene|412A1DBBE7F87765DEBEEAAE02A047636A354D5E|frlR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK32560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAGGGTAGCCTCCTTTTA,  downstream forward: _UP4_TAACAGGCATAAAAAACGAG
References
21347729,21398478

412A1DBBE7F87765DEBEEAAE02A047636A354D5E

Page visits: 1614

Time of last update: 2022-11-30 13:45:15

Author of last update: Melvin.boenninger