yxkD

yxkD
168

unknown

locus
BSU_38840
Molecular weight
30.58 kDa
pI
8.61
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yxkD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1284

This gene is a member of the following regulons

Gene
Coordinates
3,987,927  3,988,763
The protein
Protein family
[wiki|UPF0750 membrane proteins] (according to UniProt)
Structure
[AF|P94357]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|417714CA91427D583ED87E4804DE399D53A51C71|yxkD]
description
[Pubmed|10746760]
regulation
induced in the presence of guanidine ([wiki|ykkC riboswitch]) [Pubmed|27989440]
additional information
term-seq has identified a potential novel regulatory RNA element including an intrinsic transcription terminator upstream of ''yxkD'' [Pubmed|27120414]
Open in new tab

[gene|417714CA91427D583ED87E4804DE399D53A51C71|yxkD]

2022-07-17 04:59:34

ghost

6

2b8e0c74fd4ec045925adf22bcf8bce814b83833

E66EAA480D7BEBBD5E5F465A960BFF401ED0E593

Biological materials
Mutant
MGNA-B738 (yxkD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1737 NBRP B. subtilis, Japan]
BKE38840 ([gene|417714CA91427D583ED87E4804DE399D53A51C71|yxkD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38840 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCACGAAAACACTCCTTT,  downstream forward: _UP4_TAAAGAAAAATCCCTCTGTA
BKK38840 ([gene|417714CA91427D583ED87E4804DE399D53A51C71|yxkD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38840 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCACGAAAACACTCCTTT,  downstream forward: _UP4_TAAAGAAAAATCCCTCTGTA
References
Reviews
28060483
Original Publications
15096624,10746760,21317561,27120414,27989440

417714CA91427D583ED87E4804DE399D53A51C71

Page visits: 1028

Time of last update: 2022-10-03 12:20:12

Author of last update: Melvin.boenninger