pbuG

pbuG
168

hypoxanthin/ guanine permease

locus
BSU_06370
Molecular weight
46.03 kDa
pI
8.81
Protein length
Gene length
function
hypoxanthine and guanine uptake
product
hypoxanthin/ guanine permease
essential
no
ec
null
synonyms
pbuG, yebB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2252

This gene is a member of the following regulons

Gene
Coordinates
694,662  695,984
The protein
Protein family
[wiki|xanthine/uracil permease family] (according to UniProt)
Structure
[PDB|2EEW] (the pbuG riboswitch, U47c mutant, bound to hypoxanthine)
[AF|O34987]
Paralogous protein(s)
[protein|62AC66725C55B9E5FBBEB4EC43A88F7081B74D5C|pbuO]
[wiki|Localization]
membrane [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|41DDD3AAFE89D0F52AB5ABD08CEE30A1767FFD7A|pbuG]
description
[Pubmed|12923093]
regulation
repressed by hypoxanthine and guanine, [protein|search|PurR]-independent, ([protein|search|G-box])[Pubmed|12923093]
regulatory mechanism
[protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR]: repression, (molecular inducer: PRPP) [Pubmed|2536750], in [regulon|protein:A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR regulon]
G-box: termination, ([protein|C245476CE35028167510F67153F392D91447553F|mgtE riboswitch]) [Pubmed|12923093], in [regulon|other_regulator:G-box|G-box]
Open in new tab

[gene|41DDD3AAFE89D0F52AB5ABD08CEE30A1767FFD7A|pbuG]

2022-12-01 10:32:23

ghost

18

4c8ddbe117bd4abafd449e44edb39ff90066dcfe

F4B6A6136299E715D0EC9D2E5EEF9633908BEA4E

Biological materials
Mutant
BKE06370 ([gene|41DDD3AAFE89D0F52AB5ABD08CEE30A1767FFD7A|pbuG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE06370 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGCTATTTGACTCCCTTC,  downstream forward: _UP4_TAAGGAATGAAAAACCAGCT
BKK06370 ([gene|41DDD3AAFE89D0F52AB5ABD08CEE30A1767FFD7A|pbuG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK06370 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGCTATTTGACTCCCTTC,  downstream forward: _UP4_TAAGGAATGAAAAACCAGCT
References
11591660,12923093,11591660,18763711,12923093,12787499,35622174

41DDD3AAFE89D0F52AB5ABD08CEE30A1767FFD7A

Page visits: 2274

Time of last update: 2022-12-06 10:29:05

Author of last update: Jstuelk