ycxA
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

ycxA
168

unknown

locus
BSU_03530
Molecular weight
44.70 kDa
pI
8.76
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ycxA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2271

This gene is a member of the following regulons

Gene
Coordinates
403,217 → 404,443
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
Structure
[AF|Q08791]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|4264FE54F73766F7029C871E14B47DCFE5E4BC38|ycxA]
description
[pubmed|22383849]
regulation
expressed at high cell density ([protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]) [Pubmed|16091051]
regulatory mechanism
[protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]: activation, in [regulon|protein:7832489F11F606BCF637EC23BAAB41AD10237EBB|comA regulon]
additional information
[protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
Open in new tab

[gene|4264FE54F73766F7029C871E14B47DCFE5E4BC38|ycxA]

2022-06-01 05:00:06

Jstuelk

16

5063622907e63ed05894200af239f5b6fd1609e7

8215FFE036971F7A604685172A8240CA2E681A3D

Biological materials
Mutant
MGNA-C002 (ycxA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2000 NBRP B. subtilis, Japan]
BKE03530 (Δ[gene|4264FE54F73766F7029C871E14B47DCFE5E4BC38|ycxA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCGACCTGCCTTTA,  downstream forward: _UP4_TCAATATAAAAGGATCAGCA
BKK03530 (Δ[gene|4264FE54F73766F7029C871E14B47DCFE5E4BC38|ycxA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCGACCTGCCTTTA,  downstream forward: _UP4_TCAATATAAAAGGATCAGCA
References
16091051

4264FE54F73766F7029C871E14B47DCFE5E4BC38

Page visits: 1269

Time of last update: 2022-08-08 11:03:28

Author of last update: Melvin.boenninger