SubtiWiki SubtiWiki
dhbA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

dhbA
168

2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase

locus
BSU_32000
Molecular weight
27.34 kDa
pI
5.31
Protein length
Gene length
function
biosynthesis of the siderophore bacillibactin
product
2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase
essential
no
ec
1.3.1.28
synonyms
dhbA, entA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1028

This gene is a member of the following regulons

Gene
Coordinates
3,291,511  3,292,296
Phenotypes of a mutant
defective in biofilm formation, this can be suppressed by the addition of 2,3-dihydroxybenzoate to the medium [pubmed|31420537]
defective in sporulation timing [pubmed|34460312]
The protein
Catalyzed reaction/ biological activity
(2S,3S)-2,3-dihydroxy-2,3-dihydrobenzoate + NAD+ --> 2,3-dihydroxybenzoate + H+ + NADH (according to UniProt)
Protein family
[wiki|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
Structure
[PDB|2FWM] (from E. coli, 42% identity) [pubmed|16790929]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|42C8D303AABFA2A9706295A0F90B0B49F854B0BF|dhbA]-[gene|0D4D200095AD4F9B30179B9AF500306EDA61F5D1|dhbC]-[gene|B864EC6D21AD5E524AC13AE1BE41F5CD7FC399C5|dhbE]-[gene|1346D57F906EE5BD36F7FBFA1E4884EEBC8585FA|dhbB]-[gene|95B75CFF126AF0AD845E62B4036DD3B6DAC8C7FA|dhbF]-[gene|DD647083C2E6968AD26A41C9F4EFBA942D75207C|ybdZ]
description
[Pubmed|8921902]
regulation
induced by iron starvation (second wave to allow iron scavenging from the environment) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]) [Pubmed|29133393,12354229]
regulatory mechanism
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]: repression, [pubmed|12354229], in [regulon|protein:F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|kre]: repression, in [regulon|protein:65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|kre regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8550523], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI]: sigma factor, [pubmed|29914988], in [regulon|protein:3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI regulon]
additional information
the ''[gene|42C8D303AABFA2A9706295A0F90B0B49F854B0BF|dhbA]-[gene|0D4D200095AD4F9B30179B9AF500306EDA61F5D1|dhbC]-[gene|B864EC6D21AD5E524AC13AE1BE41F5CD7FC399C5|dhbE]-[gene|1346D57F906EE5BD36F7FBFA1E4884EEBC8585FA|dhbB]-[gene|95B75CFF126AF0AD845E62B4036DD3B6DAC8C7FA|dhbF]'' operon is strongly unregulated in a ''[wiki|kre]'' mutant [Pubmed|26110430]
Open in new tab

[gene|42C8D303AABFA2A9706295A0F90B0B49F854B0BF|dhbA]→[gene|DD647083C2E6968AD26A41C9F4EFBA942D75207C|ybdZ]

2021-12-30 15:24:18

Jstuelk

13

875cbc1c026244834e2efbc1140499985c0ab89d

CCA159D50C58E2078C51F543EDA686D77F6612EE

Biological materials
Mutant
BKE32000 ([gene|42C8D303AABFA2A9706295A0F90B0B49F854B0BF|dhbA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCATCAATTCCTTTCT,  downstream forward: _UP4_TAACTGAATTTAAAGGAGGT
BKK32000 ([gene|42C8D303AABFA2A9706295A0F90B0B49F854B0BF|dhbA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCATCAATTCCTTTCT,  downstream forward: _UP4_TAACTGAATTTAAAGGAGGT
References
8224884,10400588,11112781,11790741,12354229,8921902,8550523,20525796,20817675,21815947,24223955,26110430,29133393,29914988,16790929,31113899,31420537,34460312

42C8D303AABFA2A9706295A0F90B0B49F854B0BF

Page visits: 4012

Time of last update: 2022-01-18 14:51:03

Author of last update: Jstuelk