SubtiWiki SubtiWiki
yxlH

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yxlH
168

similar to multidrug-efflux transporter

locus
BSU_38640
Molecular weight
43.80 kDa
pI
9.02
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yxlH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2814

This gene is a member of the following regulons

Gene
Coordinates
3,966,745  3,967,947
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
[wiki|TCR/Tet family] (according to UniProt)
Structure
[PDB|3WDO] (26% identity) [pubmed|23950222]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|43917869D4E75015CEA23109E8F97DFFECD39C14|yxlH]
description
[Pubmed|22383849]
Open in new tab

[gene|43917869D4E75015CEA23109E8F97DFFECD39C14|yxlH]

2022-01-25 23:19:00

Jstuelk

9

bed1564d4a9b1ac57955ff3c4d529e49b6bc806c

F17EB2B3EC72EEDF4D5D09C3E2DE81A986642883

Biological materials
Mutant
MGNA-B754 (yxlH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1753 NBRP B. subtilis, Japan]
BKE38640 ([gene|43917869D4E75015CEA23109E8F97DFFECD39C14|yxlH]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38640 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGTATCTCTCCACCCCT,  downstream forward: _UP4_GCGCAAAAACGTAACATGAT
BKK38640 ([gene|43917869D4E75015CEA23109E8F97DFFECD39C14|yxlH]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38640 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGTATCTCTCCACCCCT,  downstream forward: _UP4_GCGCAAAAACGTAACATGAT
References
Research papers
23950222

43917869D4E75015CEA23109E8F97DFFECD39C14

Page visits: 862

Time of last update: 2022-01-27 13:26:11

Author of last update: Melvin.boenninger