mhqD

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

mhqD
168

may be involved in protection against methyl-hydroquinone

locus
BSU_19560
Molecular weight
22.29 kDa
pI
5.62
Protein length
Gene length
function
may be involved in protection against methyl-hydroquinone
product
unknown
essential
no
synonyms
mhqD, yodD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0400

This gene is a member of the following regulons

Gene
Coordinates
2,128,464  2,129,066
The protein
Protein family
[wiki|AB hydrolase superfamily] (according to UniProt)
Structure
[PDB|2H1I] (from B. cereus, 59% identity)
[AF|O34842]
Expression and Regulation
Operons
genes
[gene|A1CB3DCF2EC78B9B0585CA6AC6F5BB37B8AF0208|mhqE]-[gene|43CD556065D2EF14365C78E014B7B2051CA0C78F|mhqD]
description
[Pubmed|17725564]
regulation
induced by 2-methylhydroquinone ([protein|search|MhqR]) [Pubmed|17725564]
regulatory mechanism
[protein|997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR]: repression, [Pubmed|17725564], in [regulon|protein:997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|17725564], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|A1CB3DCF2EC78B9B0585CA6AC6F5BB37B8AF0208|mhqE]→[gene|43CD556065D2EF14365C78E014B7B2051CA0C78F|mhqD]

2022-05-19 16:51:07

ghost

9

c73bcc0fe564b49697d45cf6339f78a16f9599db

EF7D4F8AD102932E1FD3C87A8572EA7A1ED0F78B

Biological materials
Mutant
MGNA-B435 (yodD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1434 NBRP B. subtilis, Japan]
BKE19560 ([gene|43CD556065D2EF14365C78E014B7B2051CA0C78F|mhqD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATGCTTCATTATAAATTCCC,  downstream forward: _UP4_TAAAAAAACCTTAGTCCGGA
BKK19560 ([gene|43CD556065D2EF14365C78E014B7B2051CA0C78F|mhqD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATGCTTCATTATAAATTCCC,  downstream forward: _UP4_TAAAAAAACCTTAGTCCGGA
References
17407181,17725564

43CD556065D2EF14365C78E014B7B2051CA0C78F

Page visits: 891

Time of last update: 2022-05-23 23:48:07

Author of last update: Melvin.boenninger