ytjP

ytjP
168

similar to metallopeptidase

locus
BSU_29980
Molecular weight
50.89 kDa
pI
4.66
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ytjP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0624

This gene is a member of the following regulons

Gene
Coordinates
3,067,420  3,068,811
The protein
Protein family
[wiki|peptidase M20A family] (according to UniProt)
Structure
[PDB|3KHX] (from Staphylococcus aureus, 42% identity) [pubmed|20610394]
[AF|O34944]
Expression and Regulation
Operons
genes
[gene|44257D0FE03E3BC5B160BE70810EADFE3DA2C4F7|ytjP]
description
[Pubmed|9387221]
Open in new tab

[gene|44257D0FE03E3BC5B160BE70810EADFE3DA2C4F7|ytjP]

2022-11-30 12:01:51

ghost

20

efab70506453f5e4d1228164a493990c3a22cfb7

D25A44D1496CF39826BB029A019444A1F9C0A803

Biological materials
Mutant
MGNA-A820 (ytjP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/820 NBRP B. subtilis, Japan]
BKE29980 ([gene|44257D0FE03E3BC5B160BE70810EADFE3DA2C4F7|ytjP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE29980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATGATCCCCTTTCCGC,  downstream forward: _UP4_TAAAAGGACCGGCTTCTGCT
BKK29980 ([gene|44257D0FE03E3BC5B160BE70810EADFE3DA2C4F7|ytjP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK29980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATGATCCCCTTTCCGC,  downstream forward: _UP4_TAAAAGGACCGGCTTCTGCT
References
16479537,9387221,20610394

44257D0FE03E3BC5B160BE70810EADFE3DA2C4F7

Page visits: 1286

Time of last update: 2022-12-06 10:55:48

Author of last update: Melvin.boenninger