SubtiWiki SubtiWiki
ydeJ

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ydeJ
168

unknown

locus
BSU_05220
Molecular weight
24.21 kDa
pI
4.58
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ydeJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
569,290  569,949
The protein
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|45438A54D3B3D6F1781CB86BB6E78FB088DBAF97|ydeJ]
description
[Pubmed|20817675]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab

[gene|45438A54D3B3D6F1781CB86BB6E78FB088DBAF97|ydeJ]

2021-09-28 17:38:03

ghost

3

7f94597bd677ed08fe7b263ba8bcfc8dfee0a53c

024129F5FCA1BC66A745BEF379B6E8B38CB16E5C

Biological materials
Mutant
MGNA-C133 (ydeJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2131 NBRP B. subtilis, Japan]
BKE05220 ([gene|45438A54D3B3D6F1781CB86BB6E78FB088DBAF97|ydeJ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCATTCCTCTCTA,  downstream forward: _UP4_TAATCAGTATTCGTTTGTCT
BKK05220 ([gene|45438A54D3B3D6F1781CB86BB6E78FB088DBAF97|ydeJ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCATTCCTCTCTA,  downstream forward: _UP4_TAATCAGTATTCGTTTGTCT
References
20817675

45438A54D3B3D6F1781CB86BB6E78FB088DBAF97

Page visits: 811

Time of last update: 2022-01-18 20:10:05

Author of last update: Melvin.boenninger