yciB

yciB
168

putative L,D-transpeptidase

locus
BSU_03350
Molecular weight
21.94 kDa
pI
6.18
Protein length
Gene length
function
unknown
product
putative L,D-transpeptidase
essential
no
synonyms
yciB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1376

This gene is a member of the following regulons

Gene
Coordinates
365,170  365,754
The protein
Protein family
YkuD family (with [protein|6F256986E591DB82974A7F54EB1CE0C024A6F63B|ldt] and [protein|293794B65B9EEB7F049138F73893303BABFB9A2A|yqjB], according to UniProt)
Structure
[PDB|4LZH] (from Klebsiella pneumoniae, 27% identity)
[AF|C0SP99]
[wiki|Localization]
lipoprotein, cell membrane at the cell poles [Pubmed|20013255]
Expression and Regulation
Operons
genes
[gene|93380E8EEB672C14C9BE2B5A6D8573FBCA149514|folEB]-[gene|456AF184261976FAA73359E81443F7035F457D07|yciB]-[gene|F735802BB483C2C5437240AB2E9FC340EAA5B353|yczL]-[gene|75DB07A2704FEC2932BD0CDD24E2B3454E9551E1|zagA]
description
[Pubmed|9811636]
regulation
[wiki|folE2]: induced by zinc starvation ([protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur]) [Pubmed|12426338]
regulatory mechanism
[protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur]: repression, in the presence of zinc [Pubmed|12426338], in [regulon|protein:A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12426338], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|93380E8EEB672C14C9BE2B5A6D8573FBCA149514|folEB]→[gene|75DB07A2704FEC2932BD0CDD24E2B3454E9551E1|zagA]

2022-11-18 23:19:50

Jstuelk

37

ad7d4075bafccef586e192b5f9b59ca4750bd357

154D780A688DFF455944F618E9A71FDF4E6BA39E

Biological materials
Mutant
MGNA-B998 (yciB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1997 NBRP B. subtilis, Japan]
BKE03350 ([gene|456AF184261976FAA73359E81443F7035F457D07|yciB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGCAATAATGAATAATGAGA,  downstream forward: _UP4_TGAATTGAAAACCGTTGACA
BKK03350 ([gene|456AF184261976FAA73359E81443F7035F457D07|yciB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGCAATAATGAATAATGAGA,  downstream forward: _UP4_TGAATTGAAAACCGTTGACA
References
12426338,20013255,9811636

456AF184261976FAA73359E81443F7035F457D07

Page visits: 1343

Time of last update: 2022-11-27 00:45:37

Author of last update: Jstuelk