yisY

yisY
168

spore coat protein, similar to chloride peroxidase

locus
BSU_10900
Molecular weight
30.41 kDa
pI
6.89
Protein length
Gene length
function
protection of the spore
product
spore coat protein
essential
no
synonyms
yisY

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0596

This gene is a member of the following regulons

Gene
Coordinates
1,169,043  1,169,849
The protein
Protein family
[wiki|AB hydrolase superfamily] (according to UniProt)
[wiki|Domains]
[wiki|AB hydrolase-1 domain] (aa 23-254) (according to UniProt)
Structure
[PDB|5H3H] (from ''Exiguobacterium Antarcticum'', 52% identity)
[AF|O06734]
[wiki|Localization]
inner spore coat, localization depends on [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|safA] [Pubmed|22171814]
Expression and Regulation
Operons
genes
[gene|4591A235A80605E546EBC187038A6B88C129ADC9|yisY]
description
[Pubmed|12480901]
regulation
expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|12480901]
regulatory mechanism
[protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE]: repression, in [regulon|protein:19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|12480901], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|15383836], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15383836], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|4591A235A80605E546EBC187038A6B88C129ADC9|yisY]

2022-12-22 08:10:01

ghost

14

812ac6d01e446435874caaf5566d23fea1284747

224013424617F6A91711253BD3EB59B3E03A745A

Biological materials
Mutant
MGNA-A501 (yisY::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/501 NBRP B. subtilis, Japan]
BKE10900 ([gene|4591A235A80605E546EBC187038A6B88C129ADC9|yisY]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE10900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCGCATTCCTCCTGTT,  downstream forward: _UP4_TAAGAAAAAACCCGACATTG
BKK10900 ([gene|4591A235A80605E546EBC187038A6B88C129ADC9|yisY]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK10900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCGCATTCCTCCTGTT,  downstream forward: _UP4_TAAGAAAAAACCCGACATTG
References
12480901,22171814,15383836,35638784

4591A235A80605E546EBC187038A6B88C129ADC9

Page visits: 2438

Time of last update: 2023-02-06 05:19:55

Author of last update: Jstuelk