SubtiWiki SubtiWiki
yrkA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yrkA
168

similar to magnesium exporter

locus
BSU_26610
Molecular weight
48.82 kDa
pI
4.92
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yrkA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1253

This gene is a member of the following regulons

Gene
Coordinates
2,718,959  2,720,263
The protein
Protein family
[wiki|UPF0053 family](according to UniProt)
[wiki|Domains]
[wiki|CNNM transmembrane domain] (aa 1-201) (according to UniProt)
[wiki|DUF21 domain] (5-201)
2 [wiki|CBS domain]s (aa 220-282, aa 289-346) (according to UniProt)
Structure
[PDB|4HG0] (CorC from E. coli, corresponds to the [wiki|CBS domain]s and the C-terminal transporter-associated domain)
Paralogous protein(s)
[protein|A459410312A926365B45CEB4694DE399B38820A2|yugS], [protein|B2E9D026B668C8530C406353E3400059388566FB|yhdT], [protein|BE0777DE7C40825D4DB7252EA84AAB3892578529|mpfA], [protein|E53B8D437B848B637AEC8C1BB9428EC8B6EB280E|yqhB]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|45F03AB13292BBF0554785C7C02FE29033EDD742|yrkA]
description
[Pubmed|22383849]
Open in new tab

[gene|45F03AB13292BBF0554785C7C02FE29033EDD742|yrkA]

2022-01-25 20:39:09

Jstuelk

6

bd7a678b481d8d51ddc92dcb6c0c7be0c7cc577e

4116F56C6ED0B1844C6B1D4276A0D5762B58DBCE

Biological materials
Mutant
BKE26610 ([gene|45F03AB13292BBF0554785C7C02FE29033EDD742|yrkA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26610 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGATTTGCCTTACCTAG,  downstream forward: _UP4_TAACATCTGGATAAAACACA
BKK26610 ([gene|45F03AB13292BBF0554785C7C02FE29033EDD742|yrkA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26610 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGATTTGCCTTACCTAG,  downstream forward: _UP4_TAACATCTGGATAAAACACA
Expression vectors
pGP2932 (N-terminal His-tag, purification from ''E. coli'', in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
pGP3465 (214-350aa) (N-terminal 6xHis-tag, purification from E. coli, in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
pGP3470 (214-350aa) (N-terminal 6xHis-SUMO-tag, purification from E. coli, in pET-SUMO), available in [wiki|Jörg Stülke]'s lab
References
27933050,31415562

45F03AB13292BBF0554785C7C02FE29033EDD742

Page visits: 984

Time of last update: 2022-01-26 08:04:10

Author of last update: LKrueger