SubtiWiki SubtiWiki
psdA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

psdA
168

[wiki|ABC transporter] (ATP-binding protein) for the export of lipid II-binding lantibiotics, such as nisin and gallidermin

locus
BSU_34700
Molecular weight
28.89 kDa
pI
6.34
Protein length
Gene length
function
export of toxic peptides
product
[wiki|ABC transporter] (ATP-binding protein)
essential
no
synonyms
psdA, yvcR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1136

This gene is a member of the following regulons

Gene
Coordinates
3,565,496  3,566,275
The protein
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transporter domain] (aa 4-248) (according to UniProt)
Structure
[PDB|1L2T] (MJ0796 from '' Methanocaldococcus jannaschii '', 44% identity) [Pubmed|12150914]
Paralogous protein(s)
[protein|8B4267532B9788AEB5EF39E2695C1FDA494C7055|yxdL], [protein|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|ftsE], [protein|8E0DE8FE7E9C12495C4DCADA74D838FED088867D|bceA], [protein|FE3A01BEA974C5E32C68DC600C800E5EF101B34F|yknY], [protein|0F8048267EC038D8CF673317D969BA27735473A7|yvrO]
[wiki|Localization]
membrane associated (via [protein|AC7F08DC1DF7DD2F9AFF84041D357B286B1244AC|psdB]) [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|985E7F25C809AA5DF372101E64960DF704EED53F|psdR]-[gene|A9525886E911164BDFF0A55DA9F5FDD1C1B7A3B6|psdS]-[gene|464DD1855E6B3195EE242637612A16C73FF32FC0|psdA]-[gene|AC7F08DC1DF7DD2F9AFF84041D357B286B1244AC|psdB]
description
[Pubmed|21078927]
regulation
''[protein|search|psdA]'': induced by nisin, gallidermin ([protein|search|PsdR]) [Pubmed|21078927]
regulatory mechanism
[protein|985E7F25C809AA5DF372101E64960DF704EED53F|psdR]: activation, [Pubmed|21078927], in [regulon|protein:985E7F25C809AA5DF372101E64960DF704EED53F|psdR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|21078927], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|985E7F25C809AA5DF372101E64960DF704EED53F|psdR]→[gene|AC7F08DC1DF7DD2F9AFF84041D357B286B1244AC|psdB]

2022-01-23 03:41:20

ghost

9

d7c5e7b0711e6228a3cdf2a71273ad8f725b7c09

5FD7CD564F41C61165A1333E78C1CCE35B7CF017

genes
[gene|464DD1855E6B3195EE242637612A16C73FF32FC0|psdA]-[gene|AC7F08DC1DF7DD2F9AFF84041D357B286B1244AC|psdB]
description
[Pubmed|18394148]
regulation
''[protein|search|psdA]'': induced by nisin, gallidermin ([protein|search|PsdR]) [Pubmed|21078927]
Open in new tab

[gene|464DD1855E6B3195EE242637612A16C73FF32FC0|psdA]→[gene|AC7F08DC1DF7DD2F9AFF84041D357B286B1244AC|psdB]

2022-01-26 01:37:31

ghost

8

528cfddc9a2a0d8255143057e419a826bbda2cca

A575053EE656C7505582CC0B07D1C34F3FE06BD1

Biological materials
Mutant
MGNA-B635 (yvcR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1634 NBRP B. subtilis, Japan]
BKE34700 ([gene|464DD1855E6B3195EE242637612A16C73FF32FC0|psdA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTGCTCCTCCTTTT,  downstream forward: _UP4_TTGAGTGTGTTGGGAGGCGA
BKK34700 ([gene|464DD1855E6B3195EE242637612A16C73FF32FC0|psdA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTGCTCCTCCTTTT,  downstream forward: _UP4_TTGAGTGTGTTGGGAGGCGA
References
18394148,10092453,21283517,26364265,12150914,27997719

464DD1855E6B3195EE242637612A16C73FF32FC0

Page visits: 2239

Time of last update: 2022-01-27 21:05:16

Author of last update: Melvin.boenninger