rapD

rapD
168

response regulator aspartate phosphatase, controls [protein|search|ComA ]activity

locus
BSU_36380
Molecular weight
41.98 kDa
pI
7.69
Protein length
Gene length
function
control of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]-dependent gene expression
product
response regulator aspartate phosphatase
essential
no
synonyms
rapD, ywpA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,744,349  3,745,413
The protein
Catalyzed reaction/ biological activity
control of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]-dependent gene expression [Pubmed|17227471]
Protein family
[wiki|RAP family] (according to UniProt)
[wiki|Domains]
six [wiki|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
Structure
[PDB|4I9E] ([protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|rapF], 26% identity) [pubmed|23526880]
[AF|P94583]
Expression and Regulation
Operons
genes
[gene|4670F7C4CB9084A5BA478CAE238FA0F8C39F3A7E|rapD]
description
[Pubmed|9636707]
regulation
repressed by [protein|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|rghR] [Pubmed|17227471]
expression
expression is heterogeneous [pubmed|35171018]
regulatory mechanism
[protein|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|rghR]: repression, [Pubmed|17227471], in [regulon|protein:972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|rghR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9636707], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [Pubmed|9636707], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
Open in new tab

[gene|4670F7C4CB9084A5BA478CAE238FA0F8C39F3A7E|rapD]

2022-06-07 22:55:16

Jstuelk

16

DA83D945A00F72265CE02635358F60D8F993D15D

638827563480D98F1C54D522A5A7FE03A81382E8

Biological materials
Mutant
MGNA-A079 (rapD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/79 NBRP B. subtilis, Japan]
BKE36380 ([gene|4670F7C4CB9084A5BA478CAE238FA0F8C39F3A7E|rapD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTCCTACCTCTTTGCT,  downstream forward: _UP4_TGATTGAAAAACGCCCATTT
BKK36380 ([gene|4670F7C4CB9084A5BA478CAE238FA0F8C39F3A7E|rapD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTCCTACCTCTTTGCT,  downstream forward: _UP4_TGATTGAAAAACGCCCATTT
References
17227471,9636707,18179421,23526880,35171018

4670F7C4CB9084A5BA478CAE238FA0F8C39F3A7E

Page visits: 2647

Time of last update: 2022-06-24 08:13:15

Author of last update: Jstuelk