yotD

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

yotD
168

similar to acyl-CoA synthetase

locus
BSU_19920
Molecular weight
4.88 kDa
pI
3.82
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yotD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1592

This gene is a member of the following regulons

Gene
Coordinates
2,154,887  2,155,018
The protein
[wiki|Cofactors]
contains an iron-sulfur cluster
Structure
[AF|O34407]
Expression and Regulation
Operons
genes
[gene|AFCA823BA7245A295B3282602A928D2CD0F8CD27|yosX]-[gene|B604367A80B7D3DF4A940C12A35EDF37B0E415F2|yotB]-[gene|6416197EF316D74998012765EF9819072C38D2E2|yotC]-[gene|470037C34BD5D3EB5BDAD85BD4178ABDB6330A62|yotD]-[gene|5C8815965146BCD8ED238258B3F820AA17241165|yotE]-[gene|177BAE8E5143CBE479B8EF6814F2A1066E72D658|yotF]-[gene|CE176CE32089F79C9BAC36641DDBBA8C9C38C957|yotG]-[gene|5240CC5115326ACBB2B73F7610987C842C246F24|yotH]-[gene|ADFAFAB949F0BED0681E35C3055DB0984DA7910E|yotI]-[gene|C5508537A5CB1E2F71329CD822242EE988D395F3|yotJ]-[gene|3C740F35E67CDD7FB6BF19E0FF43F973D254EF3E|yotK]-[gene|3899DF460037B569066F452EC50AD97672AA5ACA|yotM]-[gene|46826326719EB32B5733953EC090FD91CB59C5B6|sprB]
description
[Pubmed|25299644]
regulation
''[protein|search|sprB]'': expressed during the middle and late stages of [wiki|sporulation] [Pubmed|25299644]
regulatory mechanism
[protein|6977F18870004AD236539D9409255815E6BE9241|csoR]: repression, [Pubmed|20233928], in [regulon|protein:6977F18870004AD236539D9409255815E6BE9241|csoR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|25299644], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|25299644], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
Open in new tab

[gene|AFCA823BA7245A295B3282602A928D2CD0F8CD27|yosX]→[gene|46826326719EB32B5733953EC090FD91CB59C5B6|sprB]

2022-04-08 07:07:56

ghost

12

d73f87b6e78327070acca915e541f23c48175330

06DE073536CD2A3CA0923FA8B10B026964721DB2

Biological materials
Mutant
BKE19920 ([gene|470037C34BD5D3EB5BDAD85BD4178ABDB6330A62|yotD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19920 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTATAGCTACACCTCTTT,  downstream forward: _UP4_TGATTAAGACGTTGATTTCA
BKK19920 ([gene|470037C34BD5D3EB5BDAD85BD4178ABDB6330A62|yotD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19920 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTATAGCTACACCTCTTT,  downstream forward: _UP4_TGATTAAGACGTTGATTTCA
References
25299644,9387222,20233928

470037C34BD5D3EB5BDAD85BD4178ABDB6330A62

Page visits: 989

Time of last update: 2022-05-19 19:13:51

Author of last update: Bzhu