yosM

yosM
168

putative SPbeta phage subunit of nucleoside diphosphate reductase

locus
BSU_20070
Molecular weight
14.51 kDa
pI
7.26
Protein length
Gene length
function
unknown
product
putative SPbeta phage subunit of nucleoside diphosphate reductase
essential
no
synonyms
yosM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1780

This gene is a member of the following regulons

Gene
Coordinates
2,165,577  2,165,966
The protein
Protein family
nrdI family (with [protein|1EA0595C74359A36B9161CFD531CA894C5E66E25|nrdI], according to UniProt)
Structure
[PDB|2XOD] (from Bacillus Anthracis 47% identity)
[AF|P68524]
Paralogous protein(s)
[protein|1EA0595C74359A36B9161CFD531CA894C5E66E25|nrdI]
Biological materials
Mutant
BKE20070 ([gene|47098DA18DBD3FEF9E33D21677B6D94D5B0ACB2B|yosM]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE20070 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTACTCTCATATGTAATGA,  downstream forward: _UP4_AAAATCATTCAGGAGGTACA
BKK20070 ([gene|47098DA18DBD3FEF9E33D21677B6D94D5B0ACB2B|yosM]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK20070 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTACTCTCATATGTAATGA,  downstream forward: _UP4_AAAATCATTCAGGAGGTACA

47098DA18DBD3FEF9E33D21677B6D94D5B0ACB2B

Page visits: 987

Time of last update: 2022-12-08 00:17:26

Author of last update: Melvin.boenninger