fpbP

fpbP
168

petrobactin (3.4-catecholate siderophore) [wiki|ABC transporter] (ATP-binding protein)

locus
BSU_03820
Molecular weight
28.33 kDa
pI
5.09
Protein length
Gene length
function
acquisition of iron
product
petrobactin [wiki|ABC transporter] (ATP-binding protein)
essential
no
synonyms
fpbP, yclP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4604

This gene is a member of the following regulons

Gene
Coordinates
434,256  435,014
The protein
Catalyzed reaction/ biological activity
uptake of the siderophore petrobactin [Pubmed|19955416]
Fe(III)-siderophore + ATP + H2O --> Fe(III)-siderophore + ADP + H+ + phosphate (according to UniProt)
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transporter domain] (aa 2-236) (according to UniProt)
Structure
[PDB|4YMS] (amino acid transporter from Caldanaerobacter subterraneus, 31% identity) [pubmed|25848002]
[AF|P94420]
Paralogous protein(s)
[protein|5C52DB31F378E49AABE5D937DD901A68F3810477|yusV], [protein|E70BE74D5AB4B06CDFF902E58A0B9EBF477E21EC|fhuC], [protein|E76640F895261DA34AD2342B54B43D11857AEA9A|fecF]
[wiki|Localization]
associated to the membrane (via [protein|552D4C42DCEA4625000160D2625711C61AB11661|fpbN]-[protein|EC63B5CDFDB4DF3A967ECEC40F2C44849311148B|fpbO]) [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|552D4C42DCEA4625000160D2625711C61AB11661|fpbN]-[gene|EC63B5CDFDB4DF3A967ECEC40F2C44849311148B|fpbO]-[gene|473628F86C18FE9957841F3C8B45242C90CB341D|fpbP]-[gene|C1D6D188E5BD039F32427B2A58BBFC0CC173A476|fpbQ]
description
[Pubmed|19955416]
regulation
immediately induced upon iron starvation (first wave to allow iron uptake) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]) [Pubmed|29133393,12354229]
regulatory mechanism
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]: repression, [pubmed|12354229], in [regulon|protein:F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur regulon]
Open in new tab

[gene|552D4C42DCEA4625000160D2625711C61AB11661|fpbN]→[gene|C1D6D188E5BD039F32427B2A58BBFC0CC173A476|fpbQ]

2022-11-24 10:03:09

Jstuelk

37

74ea5c8bb748d23ec3e0cc6fc1179cb8eab26119

67ED5A2606DC68A56E0956D7F4306EC013902C9F

Biological materials
Mutant
MGNA-C011 (yclP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2009 NBRP B. subtilis, Japan]
BKE03820 ([gene|473628F86C18FE9957841F3C8B45242C90CB341D|fpbP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03820 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTGTTTGCTTACATTTCTGA,  downstream forward: _UP4_TAATATATAGAAGAGGTGAG
BKK03820 ([gene|473628F86C18FE9957841F3C8B45242C90CB341D|fpbP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03820 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTGTTTGCTTACATTTCTGA,  downstream forward: _UP4_TAATATATAGAAGAGGTGAG
References
10092453,19955416,12354229,25848002,29133393

473628F86C18FE9957841F3C8B45242C90CB341D

Page visits: 2518

Time of last update: 2022-11-28 22:39:10

Author of last update: Melvin.boenninger