
At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!


transcriptional regulator ([wiki|TetR family]), control of [gene|6A68EF7BF16FC2F2C7E068F52901EF2BFD6EBF8A|qdoI]-[gene|142444E1167BA7428EB95E4418C839ADF3E728B0|yxaH] and [gene|52D560AA02F0849CB24460A496021560063B2E12|lmrA]-[gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]

Molecular weight
20.87 kDa
Protein length
Gene length
control of quercetin utilization
transcriptional regulator
qdoR, yxaF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1309

This gene is a member of the following regulons

4,107,352  4,107,927
The protein
Protein family
[wiki|TetR family]
[wiki|HTH tetR-type domain] (aa 5-65) (according to UniProt)
[PDB|1SGM] [pubmed|16475182]
Effectors of protein activity
flavonoids such as quercetin act as molecular inducers and result in release from DNA targets [Pubmed|17483215,21737930]
Paralogous protein(s)
Expression and Regulation
induced by flavonoids such as quercetin ([protein|search|QdoR], [protein|search|LmrA]) [Pubmed|17483215]
regulatory mechanism
[protein|52D560AA02F0849CB24460A496021560063B2E12|lmrA]: repression, [Pubmed|15317768], in [regulon|protein:52D560AA02F0849CB24460A496021560063B2E12|lmrA regulon]
[protein|47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR]: repression, [Pubmed|17483215], in [regulon|protein:47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR regulon]
Open in new tab


2022-05-01 20:27:38





Biological materials
MGNA-B683 (yxaF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1682 NBRP B. subtilis, Japan]
BKE39990 ([gene|47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAAAACATTCCCTCCTA,  downstream forward: _UP4_TAGCATTTTGTTATCCTTTC
BKK39990 ([gene|47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAAAACATTCCCTCCTA,  downstream forward: _UP4_TAGCATTTTGTTATCCTTTC
[wiki|Yasutaro Fujita], University of Fukuyama, Japan
Original Publications


Page visits: 1715

Time of last update: 2022-05-21 07:54:30

Author of last update: Melvin.boenninger