qdoR

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

qdoR
168

transcriptional regulator ([wiki|TetR family]), control of [gene|6A68EF7BF16FC2F2C7E068F52901EF2BFD6EBF8A|qdoI]-[gene|142444E1167BA7428EB95E4418C839ADF3E728B0|yxaH] and [gene|52D560AA02F0849CB24460A496021560063B2E12|lmrA]-[gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]

locus
BSU_39990
Molecular weight
20.87 kDa
pI
6.11
Protein length
Gene length
function
control of quercetin utilization
product
transcriptional regulator
essential
no
synonyms
qdoR, yxaF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1309

This gene is a member of the following regulons

Gene
Coordinates
4,107,352  4,107,927
The protein
Protein family
[wiki|TetR family]
[wiki|Domains]
[wiki|HTH tetR-type domain] (aa 5-65) (according to UniProt)
Structure
[PDB|1SGM] [pubmed|16475182]
[AF|P42105]
Effectors of protein activity
flavonoids such as quercetin act as molecular inducers and result in release from DNA targets [Pubmed|17483215,21737930]
Paralogous protein(s)
[protein|52D560AA02F0849CB24460A496021560063B2E12|lmrA]
Expression and Regulation
Operons
genes
[gene|47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR]
description
[Pubmed|10746760]
regulation
induced by flavonoids such as quercetin ([protein|search|QdoR], [protein|search|LmrA]) [Pubmed|17483215]
regulatory mechanism
[protein|52D560AA02F0849CB24460A496021560063B2E12|lmrA]: repression, [Pubmed|15317768], in [regulon|protein:52D560AA02F0849CB24460A496021560063B2E12|lmrA regulon]
[protein|47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR]: repression, [Pubmed|17483215], in [regulon|protein:47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR regulon]
Open in new tab

[gene|47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR]

2022-05-01 20:27:38

ghost

10

7312537e9f9e5c648c8acab0d2b4a4e145ffc023

CE3C0BAAC41DDD8B161D89D7232CE5CAFB7E8D1F

Biological materials
Mutant
MGNA-B683 (yxaF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1682 NBRP B. subtilis, Japan]
BKE39990 ([gene|47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAAAACATTCCCTCCTA,  downstream forward: _UP4_TAGCATTTTGTTATCCTTTC
BKK39990 ([gene|47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAAAACATTCCCTCCTA,  downstream forward: _UP4_TAGCATTTTGTTATCCTTTC
labs
[wiki|Yasutaro Fujita], University of Fukuyama, Japan
References
Reviews
24006471,25209494
Original Publications
17483215,10746760,21737930,16475182

47387014B5E89BF218BA94D8C2A570479B1EFD4E

Page visits: 1711

Time of last update: 2022-05-18 14:06:21

Author of last update: Melvin.boenninger