qdoR

qdoR
168

transcriptional regulator ([wiki|TetR family]), control of [gene|6A68EF7BF16FC2F2C7E068F52901EF2BFD6EBF8A|qdoI]-[gene|142444E1167BA7428EB95E4418C839ADF3E728B0|yxaH] and [gene|52D560AA02F0849CB24460A496021560063B2E12|lmrA]-[gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]

locus
BSU_39990
Molecular weight
20.87 kDa
pI
6.11
Protein length
Gene length
function
control of quercetin utilization
product
transcriptional regulator
essential
no
synonyms
qdoR, yxaF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1309

This gene is a member of the following regulons

Gene
Coordinates
4,107,352  4,107,927
The protein
Protein family
[wiki|TetR family]
[wiki|Domains]
[wiki|HTH tetR-type domain] (aa 5-65) (according to UniProt)
Structure
[PDB|1SGM] [pubmed|16475182]
[AF|P42105]
Effectors of protein activity
flavonoids such as quercetin act as molecular inducers and result in release from DNA targets [Pubmed|17483215,21737930]
Paralogous protein(s)
[protein|52D560AA02F0849CB24460A496021560063B2E12|lmrA]
Expression and Regulation
Operons
genes
[gene|47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR]
description
[Pubmed|10746760]
regulation
induced by flavonoids such as quercetin ([protein|search|QdoR], [protein|search|LmrA]) [Pubmed|17483215]
regulatory mechanism
[protein|52D560AA02F0849CB24460A496021560063B2E12|lmrA]: repression, [Pubmed|15317768], in [regulon|protein:52D560AA02F0849CB24460A496021560063B2E12|lmrA regulon]
[protein|47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR]: repression, [Pubmed|17483215], in [regulon|protein:47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR regulon]
Open in new tab

[gene|47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR]

2022-11-25 02:49:07

ghost

16

7312537e9f9e5c648c8acab0d2b4a4e145ffc023

CE3C0BAAC41DDD8B161D89D7232CE5CAFB7E8D1F

Biological materials
Mutant
MGNA-B683 (yxaF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1682 NBRP B. subtilis, Japan]
BKE39990 ([gene|47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE39990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAAAACATTCCCTCCTA,  downstream forward: _UP4_TAGCATTTTGTTATCCTTTC
BKK39990 ([gene|47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK39990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAAAACATTCCCTCCTA,  downstream forward: _UP4_TAGCATTTTGTTATCCTTTC
labs
[wiki|Yasutaro Fujita], University of Fukuyama, Japan
References
Reviews
24006471,25209494
Original Publications
17483215,10746760,21737930,16475182

47387014B5E89BF218BA94D8C2A570479B1EFD4E

Page visits: 1884

Time of last update: 2022-12-05 19:16:12

Author of last update: Melvin.boenninger