yckD

yckD
168

unknown

locus
BSU_03400
Molecular weight
12.65 kDa
pI
10.09
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yckD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
369,773  370,105
The protein
Structure
[AF|P42402]
Expression and Regulation
Operons
genes
[gene|4765B305F31765445D9F5EB0D6EDED5B38DED084|yckD]
description
[Pubmed|16497325]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|15699190], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|4765B305F31765445D9F5EB0D6EDED5B38DED084|yckD]

2023-01-02 15:20:23

ghost

11

874cb930d8e490cf34f022544d79826f42644765

B16B69BFCB82B52331E421737CCF2AB02A72547C

Biological materials
Mutant
BKE03400 ([gene|4765B305F31765445D9F5EB0D6EDED5B38DED084|yckD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03400 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCATTTTATTCCTCCAA,  downstream forward: _UP4_TAAGATTTTAAGCATCCAAT
BKK03400 ([gene|4765B305F31765445D9F5EB0D6EDED5B38DED084|yckD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03400 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCATTTTATTCCTCCAA,  downstream forward: _UP4_TAAGATTTTAAGCATCCAAT
References
15699190,16497325

4765B305F31765445D9F5EB0D6EDED5B38DED084

Page visits: 1112

Time of last update: 2023-01-31 06:05:03

Author of last update: Bzhu