yfmM

yfmM
168

similar to [wiki|ABC transporter] (ATP-binding protein)

locus
BSU_07420
Molecular weight
59.02 kDa
pI
5.11
Protein length
Gene length
function
unknown
product
[wiki|ABC transporter] (ATP-binding protein)
essential
no
synonyms
yfmM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0488

This gene is a member of the following regulons

Gene
Coordinates
814,384  815,940
The protein
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|ABCF ATPase subfamily] [pubmed|30597160]
[wiki|Domains]
2 [wiki|ABC transporter domain]s (aa 4-260, aa 324-518) (according to UniProt)
Structure
[PDB|3J5S] (EttA from E. coli, 31% identity) [pubmed|24389465]
[PDB|4FIN] (EttA from E. coli, 31% identity) [pubmed|24389466]
[AF|O34512]
Paralogous protein(s)
[protein|F69F15198ACF8A8347C450EEC09F000EECEDEC41|yfmR], [protein|1F56D3275386BB54A774BFA045C09E36D1268471|ydiF], [protein|2F79DB15D359A127C2D833CC0465E18E1725F539|ykpA]
Expression and Regulation
Operons
genes
[gene|47B644F334A0BD501E77A198A61CE0F22BAB3E5E|yfmM]
description
[pubmed|22383849]
Open in new tab

[gene|47B644F334A0BD501E77A198A61CE0F22BAB3E5E|yfmM]

2022-11-28 17:17:56

Jstuelk

16

0e54d471ca3afbf90beac7c02645a0442d319eea

3621F78170DB3AE0D247AFB1CB4B20C5A7F52F82

Biological materials
Mutant
MGNA-C238 (yfmM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2236 NBRP B. subtilis, Japan]
BKE07420 ([gene|47B644F334A0BD501E77A198A61CE0F22BAB3E5E|yfmM]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTACACCTCTATCGT,  downstream forward: _UP4_TAATTTATAAAAAAACCCGC
BKK07420 ([gene|47B644F334A0BD501E77A198A61CE0F22BAB3E5E|yfmM]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTACACCTCTATCGT,  downstream forward: _UP4_TAATTTATAAAAAAACCCGC
References
Reviews
24500425,30746819
Original Publications
10092453,24389466,24389465,27006457

47B644F334A0BD501E77A198A61CE0F22BAB3E5E

Page visits: 1082

Time of last update: 2022-11-26 19:58:39

Author of last update: Melvin.boenninger