vpr

vpr
168

minor extracellular serine protease

locus
BSU_38090
Molecular weight
85.42 kDa
pI
5.77
Protein length
Gene length
function
protein degradation
product
minor extracellular serine protease
essential
no
synonyms
vpr, ipa-45r

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1404

This gene is a member of the following regulons

Gene
Coordinates
3,907,844  3,910,264
The protein
Protein family
[wiki|peptidase S8 family] (according to UniProt)
[wiki|Domains]
Inhibitor I9 domain (aa 57-142) (according to UniProt)
Peptidase S8 domain (aa 158-579) (according to UniProt)
Structure
[AF|P29141]
[wiki|Localization]
extracellular (signal peptide) [Pubmed|18957862]
Expression and Regulation
Operons
genes
[gene|481AF959FDED9055F33524483101DA9AF2013151|vpr]
description
[Pubmed|9353933]
regulation
expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|16291680]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|25666135], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP]: activation, [Pubmed|16291680], in [regulon|protein:638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP regulon]
[protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]: repression, [Pubmed|16267290], in [regulon|protein:D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA regulon]
[protein|6740108089F13116F200C15F35C2E7561E990FEB|dnaA]: repression, [Pubmed|26020636], in [regulon|protein:6740108089F13116F200C15F35C2E7561E990FEB|dnaA regulon]
sigma factors
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, [Pubmed|25666135], in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
Open in new tab

[gene|481AF959FDED9055F33524483101DA9AF2013151|vpr]

2022-11-22 13:33:47

ghost

18

716795611eb699fcb1966c2eecfdde9177961236

C9DD489EBFD37E6E87D9A26F88E98B4BA92AE3BD

Biological materials
Mutant
KO7 (''nprE  aprE  epr  mpr  nprB  vpr  bpr''), available as BGSC 1A1133
BKE38090 ([gene|481AF959FDED9055F33524483101DA9AF2013151|vpr]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGTGTTTCCCCCTTTGT,  downstream forward: _UP4_TAAGAAAAAGCCCTGCCGAT
BKK38090 ([gene|481AF959FDED9055F33524483101DA9AF2013151|vpr]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGTGTTTCCCCCTTTGT,  downstream forward: _UP4_TAAGAAAAAGCCCTGCCGAT
References
Reviews
34410368
Original Publications
24115457,16291680,16267290,18957862,25666135,26020636,1938892

481AF959FDED9055F33524483101DA9AF2013151

Page visits: 2479

Time of last update: 2022-11-30 21:23:29

Author of last update: Jstuelk