ywhK

ywhK
168

unknown

locus
BSU_37450
Molecular weight
49.20 kDa
pI
3.75
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ywhK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3391

This gene is a member of the following regulons

Gene
Coordinates
3,844,416  3,845,771
The protein
Structure
[PDB|1L0Q] (from Methanosarcina mazei, corresponds to aa 124 ... 357, 29% identity) [pubmed|12377130]
[AF|P71003]
[wiki|Localization]
Variable (Spotty) [Pubmed|16479537]
Expression and Regulation
Operons
genes
[gene|48AFD558E71531CDBDC3983B36702819D1548E63|ywhK]-[gene|E9B2B4E505209AC9A6EA9EF5F7707E7405DC5335|ywhL]
description
[Pubmed|22383849]
Open in new tab

[gene|48AFD558E71531CDBDC3983B36702819D1548E63|ywhK]→[gene|E9B2B4E505209AC9A6EA9EF5F7707E7405DC5335|ywhL]

2022-09-14 00:44:37

Jstuelk

9

7cb164186d7dc2491818b86a310906671b0ad251

702679E9CAD6839B65B27EA059147788913956CC

Biological materials
Mutant
MGNA-A523 (ywhK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/523 NBRP B. subtilis, Japan]
BKE37450 ([gene|48AFD558E71531CDBDC3983B36702819D1548E63|ywhK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE37450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCTTCACTTCCTTTTC,  downstream forward: _UP4_TAACCGCTGCATGTTGTGCA
BKK37450 ([gene|48AFD558E71531CDBDC3983B36702819D1548E63|ywhK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK37450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCTTCACTTCCTTTTC,  downstream forward: _UP4_TAACCGCTGCATGTTGTGCA
References
12073041,16479537,12377130,34279225

48AFD558E71531CDBDC3983B36702819D1548E63

Page visits: 1411

Time of last update: 2022-09-27 20:41:01

Author of last update: Jstuelk