trpE

trpE
168

anthranilate synthase (subunit I)

locus
BSU_22680
Molecular weight
57.95 kDa
pI
5.25
Protein length
Gene length
function
biosynthesis of tryptophan
product
anthranilate synthase (subunit I)
essential
no
ec
4.1.3.27
synonyms
trpE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0147

This gene is a member of the following regulons

Gene
Coordinates
2,375,869  2,377,416
The protein
Catalyzed reaction/ biological activity
chorismate + L-glutamine --> anthranilate + H+ + L-glutamate + pyruvate (according to UniProt)
Protein family
Anthranilate synthase component I family (with [protein|B189AD3E3D18876E1956763182D835A151727392|pabB], according to UniProt)
Structure
[PDB|1I7Q] (from ''Serratia marcescens'', 42% identity, 62% similarity) [Pubmed|11371633]
[AF|P03963]
Effectors of protein activity
subject to feedback inhibtion by tryptophan [Pubmed|4956345]
Expression and Regulation
Operons
genes
[gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]
description
[Pubmed|21815947]
regulation
not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]) [Pubmed|1551827]
the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
the [wiki|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
[protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]: termination/antitermination, [pubmed|1551827], in [regulon|protein:E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB regulon]
Open in new tab

[gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]→[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]

2022-11-27 04:01:30

Jstuelk

24

53eef6e8739e58d1bed57b78e584c86a2e6ff379

37D11B58C2266E362D5C193ADEA68D53F64A90E3

genes
[gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]-[gene|4D7D62B4CDA350DCDC04E6934B5E23ECE4C57870|hisC]-[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]-[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]
description
[Pubmed|21815947]
regulation
not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]) [Pubmed|1551827]
the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
regulatory mechanism
[protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]: termination/antitermination, [pubmed|1551827], in [regulon|protein:E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB regulon]
Open in new tab

[gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]→[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]

2022-11-30 22:01:33

Jstuelk

30

a3b37416002f0f1e65847bd8d15ba18b53400752

AA88BDB7192FA5467301E36C102EEEBB21BEDA86

Biological materials
Mutant
BKE22680 ([gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGCTCTCACTCCTTATG,  downstream forward: _UP4_GCTGATGAACAGATTTCTAC
BKK22680 ([gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGCTCTCACTCCTTATG,  downstream forward: _UP4_GCTGATGAACAGATTTCTAC
References
Reviews
19385727,16285852,12966138
Other original publications
4956345,3924737,6436812,21815947
The ''trpE'' [wiki|RNA switch]
20384694,19033375,17881743,7515880,2422155,3133360,7678334,7592410,14976255,2422155,8419914,1551827,16285852,10714985,11566991,12963367,14712717,21097886,24505391,24682818,29794222

48C33A96F3B446440D4D9A86AA07AA3BA244063D

Page visits: 3222

Time of last update: 2022-11-28 20:04:18

Author of last update: Melvin.boenninger