liaR

liaR
168

two-component response regulator, regulation of the [gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]-[gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]-[gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]-[gene|C107A958DFA2B0DA4837E2F9F648CD329A3116AC|liaF]-[gene|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|liaS]-[gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR] operon in response to bacitracin

locus
BSU_33080
Molecular weight
22.98 kDa
pI
4.96
Protein length
Gene length
function
regulation of the [gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]-[gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]-[gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]-[gene|C107A958DFA2B0DA4837E2F9F648CD329A3116AC|liaF]-[gene|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|liaS]-[gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR] operon
product
two-component response regulator
essential
no
synonyms
liaR, yvqC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2197

This gene is a member of the following regulons

Gene
Coordinates
3,394,422  3,395,057
The protein
Catalyzed reaction/ biological activity
regulation of the  ''[gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]-[gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]-[gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]-[gene|C107A958DFA2B0DA4837E2F9F648CD329A3116AC|liaF]-[gene|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|liaS]-[gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]'' operon in response to bacitracin
[wiki|Domains]
[wiki|Response regulatory domain] (aa 3-119) (according to UniProt)
[wiki|HTH luxR-type domain] (aa 143-208) (according to UniProt)
Structure
[PDB|5HEV] ([protein|search|LiaR ]from Enterococcus faecium, 62% identity) [pubmed|27670715]
[AF|O32197]
Modification
phosphorylation on a Asp residue by [protein|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|liaS]
Paralogous protein(s)
[protein|DD799ED3EB79457C27ED30C7B4DBBC2C8F962191|yhcZ], [protein|EFEAF09E4449A022A7323450FDED9458426A0080|ydfI], [protein|23F365C23BDEE02D42C9355FC7D2A65DAF9F79ED|yxjL], [protein|387EF370CE24F7A3C20789A57329A02EBED46F53|lnrK]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]-[gene|C107A958DFA2B0DA4837E2F9F648CD329A3116AC|liaF]-[gene|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|liaS]-[gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]
description
[Pubmed|16816187]
regulation
''[protein|search|liaG]'': constitutive
regulatory mechanism
[protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]: activation, [Pubmed|16816187], in [regulon|protein:49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15273097], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]→[gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]

2023-01-31 11:14:57

ghost

34

2f16b4fd354512d8414b5b6145620bdeaa475d46

AF84222759CC1E14AC8022D48DBA6522494204CA

genes
[gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]-[gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]-[gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]-[gene|C107A958DFA2B0DA4837E2F9F648CD329A3116AC|liaF]-[gene|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|liaS]-[gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]
description
[Pubmed|14651641]
regulation
''[protein|search|liaG]'': constitutive
Open in new tab

[gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]→[gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]

2023-01-31 06:32:58

ghost

41

844f52131490c84c9a0558a221a24520579ef3fd

F37C9323D2117C9590CDC8EC3E6B0E3F58AFC1F7

Biological materials
Mutant
MGNA-B034 (yvqC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1033 NBRP B. subtilis, Japan]
BKE33080 ([gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE33080 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CCCCATTCTGACCATTTCAT,  downstream forward: _UP4_AATCATCTCGTGAATTAGGC
BKK33080 ([gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK33080 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CCCCATTCTGACCATTTCAT,  downstream forward: _UP4_AATCATCTCGTGAATTAGGC
labs
[wiki|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
References
Reviews
27344142
Original Publications
18394148,19164152,15273097,17921301,10094672,19164157,14651641,17600057,17660417,16816187,15101989,17660417,20057163,20817675,20639339,23279150,22964256,22092710,23326432,27791134,27856233,27670715,29185696,32117169,30848888,32349670,33114184

49E70A20CC05DBE485953C0AE34E634EFB33C3B2

Page visits: 3292

Time of last update: 2023-02-07 09:11:44

Author of last update: Christoph.elfmann