yesM

yesM
168

two-component sensor kinase

locus
BSU_06950
Molecular weight
66.17 kDa
pI
7.28
Protein length
Gene length
function
unknown
product
two-component sensor kinase
essential
no
ec
null
synonyms
yesM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2972

This gene is a member of the following regulons

Gene
Coordinates
758,719  760,452
The protein
Catalyzed reaction/ biological activity
autophosphorylation, phosphorylation of [protein|F09661C8A483D0FC796204102021104A4373F895|yesN]
ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
[wiki|Domains]
two transmembrane segments
[wiki|HAMP domain] (aa 312-368) (according to UniProt)
[wiki|Histidine kinase domain] (aa 365-574) (according to UniProt)
Structure
[AF|O31516]
Modification
autophosphorylation on a His residue
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|EA17F9BBA4473C714711EB7577044402CD38B59C|yesL]-[gene|4A0961B9B760D4AA968B750ECE634B13039F9FC5|yesM]-[gene|F09661C8A483D0FC796204102021104A4373F895|yesN]
description
[pubmed|22383849]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
Open in new tab

[gene|EA17F9BBA4473C714711EB7577044402CD38B59C|yesL]->[gene|F09661C8A483D0FC796204102021104A4373F895|yesN]

2022-06-24 13:50:17

Bzhu

11

0a0856680046f4a9a13db901ea1db74d20547b9b

13801837B9137F1D6F2BEE3267F800035E9436AB

Biological materials
Mutant
MGNA-A945 (yesM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/945 NBRP B. subtilis, Japan]
BKE06950 ([gene|4A0961B9B760D4AA968B750ECE634B13039F9FC5|yesM]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06950 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GTACCAGCCAGCAACTCTTT,  downstream forward: _UP4_CCGTGCCGAAATGAGGTGGT
BKK06950 ([gene|4A0961B9B760D4AA968B750ECE634B13039F9FC5|yesM]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06950 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GTACCAGCCAGCAACTCTTT,  downstream forward: _UP4_CCGTGCCGAAATGAGGTGGT
References
10094672,12850135

4A0961B9B760D4AA968B750ECE634B13039F9FC5

Page visits: 1878

Time of last update: 2022-06-21 02:21:01

Author of last update: Melvin.boenninger