SubtiWiki SubtiWiki
iolT

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

iolT
168

major transporter for inositol

locus
BSU_06230
Molecular weight
51.47 kDa
pI
9.57
Protein length
Gene length
function
myo-inositol uptake
product
major transporter for inositol
essential
no
synonyms
iolT, ydjK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2814

This gene is a member of the following regulons

Gene
Coordinates
676,442  677,863
The protein
Catalyzed reaction/ biological activity
transport of myo-inositol [Pubmed|20530884]
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
[wiki|Sugar transporter (TC 2.A.1.1) family] (according to UniProt)
Structure
[PDB|4LDS] (glucose transporter from Staphylococcus epidermidis, 36% identity) [pubmed|24127585]
Paralogous protein(s)
[protein|4A77316AA94F9C11DB70AB76711AACBD28098AA1|IolT], [protein|770D9A5BEEEABE9C3FC772E74001329206ECFAB3|araE], [protein|7CE5A42042E5D52768735E795DB805530691D8A6|ywtG], [protein|8B0701B5694ABA8142476CB896E590FE1981D7DB|yfiG], [protein|A84AC4E40E7C722E27AE9C24ACECFEABD51B57BE|yncC], [protein|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|csbC]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|4A77316AA94F9C11DB70AB76711AACBD28098AA1|iolT]
description
[pubmed|22383849]
regulation
induced in the presence of inositol ([protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]) [Pubmed|11807058]
regulatory mechanism
[protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]: repression, [pubmed|11807058], in [regulon|protein:5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR regulon]
Open in new tab

[gene|4A77316AA94F9C11DB70AB76711AACBD28098AA1|iolT]

2022-01-27 15:57:58

Bzhu

4

6a1338438d535d68dd072e0d79d846b1882bfdca

67755B298561AD189D7FCF9405D6F36C3149DFD4

Biological materials
Mutant
MGNA-C218 (ydjK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2216 NBRP B. subtilis, Japan]
BKE06230 ([gene|4A77316AA94F9C11DB70AB76711AACBD28098AA1|iolT]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACTGTTTCCCCCAGTCT,  downstream forward: _UP4_TAATTTAAAAAAGAATCCGC
BKK06230 ([gene|4A77316AA94F9C11DB70AB76711AACBD28098AA1|iolT]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACTGTTTCCCCCAGTCT,  downstream forward: _UP4_TAATTTAAAAAAGAATCCGC
References
11807058,20530884,28431560,24127585

4A77316AA94F9C11DB70AB76711AACBD28098AA1

Page visits: 1687

Time of last update: 2022-01-28 10:53:55

Author of last update: Melvin.boenninger