yrvC

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

yrvC
168

unknown

locus
BSU_27640
Molecular weight
18.20 kDa
pI
4.87
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yrvC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0490

This gene is a member of the following regulons

Gene
Coordinates
2,826,245  2,826,742
The protein
[wiki|Domains]
contains a [wiki|RCK_C domain] (aa 76-161) at the C-terminus (according to [http://www.uniprot.org/uniprot/?query=RCK+C-terminal+domain&sort=score UniProt])
Structure
[AF|O32046]
Expression and Regulation
Operons
genes
[gene|4AF865F1E16187F89C1FE19BAE5C2CF2C0A53E4A|yrvC]-[gene|418A95E9DD8DE2690C1E65E2A4198E5C5AC6E6D3|yrvD]
description
[Pubmed|22383849]
Open in new tab

[gene|4AF865F1E16187F89C1FE19BAE5C2CF2C0A53E4A|yrvC]→[gene|418A95E9DD8DE2690C1E65E2A4198E5C5AC6E6D3|yrvD]

2022-03-01 22:27:10

Jstuelk

11

af3d067a525263c878094d6c21d9893e19956cbf

2FB2CA844109536E77F58CF246F2015FF9EA7ADE

Biological materials
Mutant
MGNA-B518 (yrvC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1517 NBRP B. subtilis, Japan]
GP2099 ([gene|4AF865F1E16187F89C1FE19BAE5C2CF2C0A53E4A|yrvC]-[gene|418A95E9DD8DE2690C1E65E2A4198E5C5AC6E6D3|yrvD]::''zeo''), available in [wiki|Jörg Stülke]'s lab
BKE27640 ([gene|4AF865F1E16187F89C1FE19BAE5C2CF2C0A53E4A|yrvC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27640 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATATAAACCCTCCTACA,  downstream forward: _UP4_TAACCTAGTGTTAAGCCATG
BKK27640 ([gene|4AF865F1E16187F89C1FE19BAE5C2CF2C0A53E4A|yrvC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27640 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATATAAACCCTCCTACA,  downstream forward: _UP4_TAACCTAGTGTTAAGCCATG
GP2713 ([gene|4AF865F1E16187F89C1FE19BAE5C2CF2C0A53E4A|yrvC]-[gene|418A95E9DD8DE2690C1E65E2A4198E5C5AC6E6D3|yrvD]::''cat''), available in [wiki|Jörg Stülke]'s lab
Expression vectors
pGP2908 (N-terminal His-tag, purification from ''E. coli'', in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
References
Reviews
31361596

4AF865F1E16187F89C1FE19BAE5C2CF2C0A53E4A

Page visits: 890

Time of last update: 2022-05-25 00:31:55

Author of last update: Melvin.boenninger