dgcP

dgcP
168

diguanylate cyclase

locus
BSU_29650
Molecular weight
65.30 kDa
pI
5.7
Protein length
Gene length
function
synthesis of c-di-GMP
product
diguanylate cyclase
essential
no
synonyms
dgcP, ytrP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2199

This gene is a member of the following regulons

Gene
Coordinates
3,033,696  3,035,435
The protein
Catalyzed reaction/ biological activity
synthesis of c-di-GMP from two molecules of GTP [Pubmed|23893111]
[wiki|Domains]
contains an N-terminal GAF domain [Pubmed|23893111]
contains a C-terminal [wiki|GGDEF domain] [Pubmed|22821967]
Structure
[AF|O34325]
[wiki|Localization]
cytoplasma, forms subcellular clusters at the periphery of exponentially growing cells [pubmed|28536559]
Expression and Regulation
Operons
genes
[gene|4C577B2CEDD9CD2CBFAF036EF36C9EFAF16F923F|dgcP]
description
[pubmed|22383849]
Open in new tab

[gene|4C577B2CEDD9CD2CBFAF036EF36C9EFAF16F923F|dgcP]

2022-11-28 23:37:10

Jstuelk

21

1c05196cc388b5a5393570d3ecbbb97203a6f42a

D0F91CAF30639CE3550280CD0087A96064D0BC5E

Biological materials
Mutant
MGNA-A425 (ytrP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/425 NBRP B. subtilis, Japan]
GP1591 (tet) available in [wiki|Jörg Stülke]'s lab
BKE29650 ([gene|4C577B2CEDD9CD2CBFAF036EF36C9EFAF16F923F|dgcP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE29650 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTTATCACCTAAAA,  downstream forward: _UP4_TAAAAAAAGCCCAAAACGAT
BKK29650 ([gene|4C577B2CEDD9CD2CBFAF036EF36C9EFAF16F923F|dgcP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK29650 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTTATCACCTAAAA,  downstream forward: _UP4_TAAAAAAAGCCCAAAACGAT
References
23893111,22821967,28536559,32156823

4C577B2CEDD9CD2CBFAF036EF36C9EFAF16F923F

Page visits: 2318

Time of last update: 2022-12-04 09:22:26

Author of last update: Jstuelk