ydeG

ydeG
168

similar to metabolite transport protein

locus
BSU_05190
Molecular weight
43.89 kDa
pI
9.75
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ydeG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2271

This gene is a member of the following regulons

Gene
Coordinates
566,211  567,503
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
Structure
[AF|P96664]
[wiki|Localization]
cell membrane (according to UniProt)
Biological materials
Mutant
MGNA-C130 (ydeG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2128 NBRP B. subtilis, Japan]
BKE05190 ([gene|4CDEE1AD400AD49D5B34C5FE2010B8F47BB37E38|ydeG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE05190 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTGACCTTCCTTTCTAA,  downstream forward: _UP4_TAAAGGGTAGGATTGTTTAA
BKK05190 ([gene|4CDEE1AD400AD49D5B34C5FE2010B8F47BB37E38|ydeG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK05190 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTGACCTTCCTTTCTAA,  downstream forward: _UP4_TAAAGGGTAGGATTGTTTAA

4CDEE1AD400AD49D5B34C5FE2010B8F47BB37E38

Page visits: 933

Time of last update: 2022-12-01 01:22:53

Author of last update: Melvin.boenninger