SubtiWiki SubtiWiki
bstA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

bstA
168

bacillithiol S-transferase

locus
BSU_08390
Molecular weight
20.52 kDa
pI
6.61
Protein length
Gene length
function
detoxification
product
bacillithiol S-transferase
essential
no
synonyms
bstA, yfiT

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
913,924  914,460
The protein
Protein family
[wiki|S-transferase-like (STL) superfamily] [pubmed|29451913]
metal hydrolase YfiT family (single member, according to UniProt)
[wiki|Cofactors]
Ni(2+) [Pubmed|15581359]
Structure
[PDB|1RXQ] [pubmed|15581359]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|4CF981E8DFBF07A8E7AF8623788A5812328E54BE|bstA]
description
[pubmed|22383849]
Open in new tab

[gene|4CF981E8DFBF07A8E7AF8623788A5812328E54BE|bstA]

2021-11-14 20:09:37

Jstuelk

3

b725e7a73d00c8a291105ad2da5d3517de0b761a

4A1D82C722DD8ED50E845FE67C7E6ED58B313843

Biological materials
Mutant
MGNA-C307 (yfiT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2305 NBRP B. subtilis, Japan]
BKE08390 ([gene|4CF981E8DFBF07A8E7AF8623788A5812328E54BE|bstA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08390 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAATGTTCTCCCTTCTA,  downstream forward: _UP4_CTTTCCAGACGGATGGGGTG
BKK08390 ([gene|4CF981E8DFBF07A8E7AF8623788A5812328E54BE|bstA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08390 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAATGTTCTCCCTTCTA,  downstream forward: _UP4_CTTTCCAGACGGATGGGGTG
References
15581359,22059487,24821014,29451913

4CF981E8DFBF07A8E7AF8623788A5812328E54BE

Page visits: 1392

Time of last update: 2022-01-18 18:25:15

Author of last update: Melvin.boenninger