mtlD

mtlD
168

mannitol-1-phosphate 5-dehydrogenase

locus
BSU_03990
Molecular weight
40.31 kDa
pI
6.29
Protein length
Gene length
function
mannitol utilization
product
mannitol-1-phosphate 5-dehydrogenase
essential
no
ec
1.1.1.17
synonyms
mtlD, mtlB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0246

This gene is a member of the following regulons

Gene
Coordinates
451,618  452,739
The protein
Catalyzed reaction/ biological activity
D-mannitol 1-phosphate + NAD+ --> β-D-fructose 6-phosphate + NADH (according to UniProt)
Protein family
mannitol dehydrogenase family (with [protein|A1C64447E0074B06C9210CC51680273FAAE703FA|uxaB], according to UniProt)
Structure
[PDB|3H2Z] (from ''Shigella flexneri 2a str. 2457t mutant'', 42% identity, 59% similarity)
[AF|P42957]
Expression and Regulation
Operons
genes
[gene|5291FEF41CA547223EDF9EBAFA38D3EE550ED3F3|mtlA]-[gene|EE4A4336E25F5DCAC89214F55CDE203AB47AA249|mtlF]-[gene|4D54898D405EA25A0C74B1F02A492143D49B7B07|mtlD]
description
[Pubmed|12897001]
regulation
induced by mannitol ([protein|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|mtlR]) [Pubmed|20444094]
regulatory mechanism
[protein|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|mtlR]: activation, [Pubmed|20444094], in [regulon|protein:1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|mtlR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|22014119], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
An [wiki|ncRNA|antisense RNA] is predicted for [gene|4D54898D405EA25A0C74B1F02A492143D49B7B07|mtlD] [PubMed|20525796]
Open in new tab

[gene|5291FEF41CA547223EDF9EBAFA38D3EE550ED3F3|mtlA]→[gene|4D54898D405EA25A0C74B1F02A492143D49B7B07|mtlD]

2022-10-03 16:42:50

Jstuelk

12

5bae19b2d80b020443468ffbe472a91dbcc86cee

F44226BCF3EE1A7B00EEDFF583F5DD4C12739D38

Biological materials
Mutant
MGNA-C019 (mtlD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2017 NBRP B. subtilis, Japan]
BKE03990 ([gene|4D54898D405EA25A0C74B1F02A492143D49B7B07|mtlD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGCACCGAAATGTAAGGCGA,  downstream forward: _UP4_TAACCGACCACCCGTGACAC
BKK03990 ([gene|4D54898D405EA25A0C74B1F02A492143D49B7B07|mtlD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGCACCGAAATGTAAGGCGA,  downstream forward: _UP4_TAACCGACCACCCGTGACAC
References
12897001,20444094,10627040,20525796

4D54898D405EA25A0C74B1F02A492143D49B7B07

Page visits: 1978

Time of last update: 2022-10-03 22:04:51

Author of last update: Melvin.boenninger