comS

comS
168

antiadaptor protein, assembly link between regulatory components of the competence signal transduction pathway

locus
BSU_03500
Molecular weight
5.11 kDa
pI
9.15
Protein length
Gene length
function
control of ComK degradation
product
antiadaptor protein (anti-MecA)
essential
no
synonyms
comS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
390,880  391,020
Phenotypes of a mutant
loss of [wiki|genetic competence] [Pubmed|7752896]
overexpression of [protein|4D76F07D6124D56C7CEBBDAB9E84B2718BF1E7FC|comS] results in expression of competence genes in 80% to 90% of the cells [Pubmed|8878039]
The protein
Structure
[AF|P80355]
Expression and Regulation
Operons
genes
[gene|81845F44CE2C601555066E31E87384FF5D7B4139|srfAA]-[gene|3C484FDB3A440269E87D6B6E8500A875AC456666|srfAB]-[gene|4D76F07D6124D56C7CEBBDAB9E84B2718BF1E7FC|comS]-[gene|1D5F227860A321506A1AB4BAE63CAD3A66E43BFC|srfAC]-[gene|9D0914FC38FFF4028C2BA5970DC87B3A1027E253|srfAD]
description
[Pubmed|1715856]
regulation
expressed at high cell density ([protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]) [Pubmed|16091051]
heterogeneous expression, percentage of expressing cells increases during colonization of plant roots [pubmed|34557426]
regulatory mechanism
[protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP]: activation, [Pubmed|25666134], in [regulon|protein:638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|8830686], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]: activation, [Pubmed|1715856,16091051], in [regulon|protein:7832489F11F606BCF637EC23BAAB41AD10237EBB|comA regulon]
[protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR]: activation, [Pubmed|16166527], in [regulon|protein:00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR regulon]
[protein|2C6386E9A63F410558D168798D077DF91590F454|spx]: repression, [Pubmed|12642660], in [regulon|protein:2C6386E9A63F410558D168798D077DF91590F454|spx regulon]
[protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh]: repression, [Pubmed|20817675], in [regulon|protein:5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1715856], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
A [protein|search|ncRNA] is predicted between '[protein|D9A187961CFB9496A6712E9E48AAD384357A3E1C|hxlR]' and '[protein|81845F44CE2C601555066E31E87384FF5D7B4139|srfAA]' [PubMed|20525796]
Open in new tab

[gene|81845F44CE2C601555066E31E87384FF5D7B4139|srfAA]→[gene|9D0914FC38FFF4028C2BA5970DC87B3A1027E253|srfAD]

2022-06-11 03:27:54

Jstuelk

36

620D29280C2CC5BBF61DFDE1E763667777B28513

4F5B391B1D8CC1181EDE8EB2DAC874A9B90A39CA

Biological materials
Mutant
BKE03500 ([gene|4D76F07D6124D56C7CEBBDAB9E84B2718BF1E7FC|comS]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03500 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTTGCCTGATCGGTTCAAACG,  downstream forward: _UP4_AAGTAGATAAAGACCGGCTTG
BKK03500 ([gene|4D76F07D6124D56C7CEBBDAB9E84B2718BF1E7FC|comS]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03500 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTTGCCTGATCGGTTCAAACG,  downstream forward: _UP4_AAGTAGATAAAGACCGGCTTG
References
Reviews
19609260
Original Publications
17560370,10447896,12642660,9000055,10361283,10447896,11703662,1715856,16091051,20817675,8878039,7752896,27045827

4D76F07D6124D56C7CEBBDAB9E84B2718BF1E7FC

Page visits: 3027

Time of last update: 2022-06-24 04:33:02

Author of last update: Bzhu