

required for sporulation at a late stage

Molecular weight
24.95 kDa
Protein length
Gene length

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5869

This gene is a member of the following regulons

68,515  69,150
Phenotypes of a mutant
inactivation of ''[gene|4DEDB27C0162409571AB4A1BB17CFE400764AE45|yabQ]'' reduces sporulation efficiency to 0.1% that of wild type cells [Pubmed|26735940]
The protein
forespore outer membrane (according to UniProt)
Expression and Regulation
expressed during sporulation ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]) [Pubmed|11283287]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190,11283287], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|12207695], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|26577401], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [Pubmed|12207695], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
Open in new tab


2022-11-22 17:48:11





expressed during sporulation ([protein|search|SigE]) [Pubmed|11283287]
additional information
there are about 50,000 molecules of DivIC per cell [http://www.ncbi.nlm.nih.gov/sites/entrez/9426141 PubMed]
Open in new tab


2022-11-26 18:07:17





Biological materials
MGNA-B918 (yabQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1917 NBRP B. subtilis, Japan]
BKE00610 ([gene|4DEDB27C0162409571AB4A1BB17CFE400764AE45|yabQ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00610 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGTATAGAATTGTGTCGTCA,  downstream forward: _UP4_AGATGAAAGGAGGACCGTCT
BKK00610 ([gene|4DEDB27C0162409571AB4A1BB17CFE400764AE45|yabQ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00610 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGTATAGAATTGTGTCGTCA,  downstream forward: _UP4_AGATGAAAGGAGGACCGTCT


Page visits: 2092

Time of last update: 2022-11-28 21:54:18

Author of last update: Jstuelk